ID: 1178898939

View in Genome Browser
Species Human (GRCh38)
Location 21:36583736-36583758
Sequence ATGAGCTCCCTCCCCTGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178898939_1178898942 -8 Left 1178898939 21:36583736-36583758 CCCATCCAGGGGAGGGAGCTCAT No data
Right 1178898942 21:36583751-36583773 GAGCTCATTAGCATAACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178898939 Original CRISPR ATGAGCTCCCTCCCCTGGAT GGG (reversed) Intergenic