ID: 1178903415

View in Genome Browser
Species Human (GRCh38)
Location 21:36615861-36615883
Sequence CTTTATGTCCAGATGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178903415_1178903420 12 Left 1178903415 21:36615861-36615883 CCTTTCTCCATCTGGACATAAAG No data
Right 1178903420 21:36615896-36615918 AAGACTGGGCTGACCATGAGTGG No data
1178903415_1178903419 -2 Left 1178903415 21:36615861-36615883 CCTTTCTCCATCTGGACATAAAG No data
Right 1178903419 21:36615882-36615904 AGAACTTATGGAGAAAGACTGGG No data
1178903415_1178903422 28 Left 1178903415 21:36615861-36615883 CCTTTCTCCATCTGGACATAAAG No data
Right 1178903422 21:36615912-36615934 TGAGTGGTAGAACAAAAATAAGG No data
1178903415_1178903418 -3 Left 1178903415 21:36615861-36615883 CCTTTCTCCATCTGGACATAAAG No data
Right 1178903418 21:36615881-36615903 AAGAACTTATGGAGAAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178903415 Original CRISPR CTTTATGTCCAGATGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr