ID: 1178903419

View in Genome Browser
Species Human (GRCh38)
Location 21:36615882-36615904
Sequence AGAACTTATGGAGAAAGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178903415_1178903419 -2 Left 1178903415 21:36615861-36615883 CCTTTCTCCATCTGGACATAAAG No data
Right 1178903419 21:36615882-36615904 AGAACTTATGGAGAAAGACTGGG No data
1178903416_1178903419 -9 Left 1178903416 21:36615868-36615890 CCATCTGGACATAAAGAACTTAT No data
Right 1178903419 21:36615882-36615904 AGAACTTATGGAGAAAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178903419 Original CRISPR AGAACTTATGGAGAAAGACT GGG Intergenic
No off target data available for this crispr