ID: 1178903422

View in Genome Browser
Species Human (GRCh38)
Location 21:36615912-36615934
Sequence TGAGTGGTAGAACAAAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178903415_1178903422 28 Left 1178903415 21:36615861-36615883 CCTTTCTCCATCTGGACATAAAG No data
Right 1178903422 21:36615912-36615934 TGAGTGGTAGAACAAAAATAAGG No data
1178903416_1178903422 21 Left 1178903416 21:36615868-36615890 CCATCTGGACATAAAGAACTTAT No data
Right 1178903422 21:36615912-36615934 TGAGTGGTAGAACAAAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178903422 Original CRISPR TGAGTGGTAGAACAAAAATA AGG Intergenic
No off target data available for this crispr