ID: 1178907648

View in Genome Browser
Species Human (GRCh38)
Location 21:36649939-36649961
Sequence CCGCCTCCAAGGTTAGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178907648_1178907652 1 Left 1178907648 21:36649939-36649961 CCACAGGCTAACCTTGGAGGCGG No data
Right 1178907652 21:36649963-36649985 CATCATCTCCCAGTGAGCCTTGG No data
1178907648_1178907660 19 Left 1178907648 21:36649939-36649961 CCACAGGCTAACCTTGGAGGCGG No data
Right 1178907660 21:36649981-36650003 CTTGGGGGACTGATGGAATTTGG No data
1178907648_1178907655 4 Left 1178907648 21:36649939-36649961 CCACAGGCTAACCTTGGAGGCGG No data
Right 1178907655 21:36649966-36649988 CATCTCCCAGTGAGCCTTGGGGG No data
1178907648_1178907653 2 Left 1178907648 21:36649939-36649961 CCACAGGCTAACCTTGGAGGCGG No data
Right 1178907653 21:36649964-36649986 ATCATCTCCCAGTGAGCCTTGGG No data
1178907648_1178907661 24 Left 1178907648 21:36649939-36649961 CCACAGGCTAACCTTGGAGGCGG No data
Right 1178907661 21:36649986-36650008 GGGACTGATGGAATTTGGTGAGG No data
1178907648_1178907654 3 Left 1178907648 21:36649939-36649961 CCACAGGCTAACCTTGGAGGCGG No data
Right 1178907654 21:36649965-36649987 TCATCTCCCAGTGAGCCTTGGGG No data
1178907648_1178907658 12 Left 1178907648 21:36649939-36649961 CCACAGGCTAACCTTGGAGGCGG No data
Right 1178907658 21:36649974-36649996 AGTGAGCCTTGGGGGACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178907648 Original CRISPR CCGCCTCCAAGGTTAGCCTG TGG (reversed) Intergenic
No off target data available for this crispr