ID: 1178907665

View in Genome Browser
Species Human (GRCh38)
Location 21:36650011-36650033
Sequence CTAAAGCACCGGGCCTGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178907659_1178907665 8 Left 1178907659 21:36649980-36650002 CCTTGGGGGACTGATGGAATTTG No data
Right 1178907665 21:36650011-36650033 CTAAAGCACCGGGCCTGCCCGGG No data
1178907657_1178907665 16 Left 1178907657 21:36649972-36649994 CCAGTGAGCCTTGGGGGACTGAT No data
Right 1178907665 21:36650011-36650033 CTAAAGCACCGGGCCTGCCCGGG No data
1178907656_1178907665 17 Left 1178907656 21:36649971-36649993 CCCAGTGAGCCTTGGGGGACTGA No data
Right 1178907665 21:36650011-36650033 CTAAAGCACCGGGCCTGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178907665 Original CRISPR CTAAAGCACCGGGCCTGCCC GGG Intergenic
No off target data available for this crispr