ID: 1178907806

View in Genome Browser
Species Human (GRCh38)
Location 21:36650845-36650867
Sequence ATGTTGCCACATCCTCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178907806_1178907817 30 Left 1178907806 21:36650845-36650867 CCCTCTGGAGGATGTGGCAACAT No data
Right 1178907817 21:36650898-36650920 CTGTGAGTGCCTTGGACTCCCGG No data
1178907806_1178907810 -5 Left 1178907806 21:36650845-36650867 CCCTCTGGAGGATGTGGCAACAT No data
Right 1178907810 21:36650863-36650885 AACATGTGCCATCTTGGGAGTGG No data
1178907806_1178907814 22 Left 1178907806 21:36650845-36650867 CCCTCTGGAGGATGTGGCAACAT No data
Right 1178907814 21:36650890-36650912 CAGGCCCTCTGTGAGTGCCTTGG No data
1178907806_1178907809 -10 Left 1178907806 21:36650845-36650867 CCCTCTGGAGGATGTGGCAACAT No data
Right 1178907809 21:36650858-36650880 GTGGCAACATGTGCCATCTTGGG No data
1178907806_1178907812 3 Left 1178907806 21:36650845-36650867 CCCTCTGGAGGATGTGGCAACAT No data
Right 1178907812 21:36650871-36650893 CCATCTTGGGAGTGGAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178907806 Original CRISPR ATGTTGCCACATCCTCCAGA GGG (reversed) Intergenic
No off target data available for this crispr