ID: 1178907807

View in Genome Browser
Species Human (GRCh38)
Location 21:36650846-36650868
Sequence CATGTTGCCACATCCTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178907807_1178907817 29 Left 1178907807 21:36650846-36650868 CCTCTGGAGGATGTGGCAACATG No data
Right 1178907817 21:36650898-36650920 CTGTGAGTGCCTTGGACTCCCGG No data
1178907807_1178907812 2 Left 1178907807 21:36650846-36650868 CCTCTGGAGGATGTGGCAACATG No data
Right 1178907812 21:36650871-36650893 CCATCTTGGGAGTGGAGACCAGG No data
1178907807_1178907810 -6 Left 1178907807 21:36650846-36650868 CCTCTGGAGGATGTGGCAACATG No data
Right 1178907810 21:36650863-36650885 AACATGTGCCATCTTGGGAGTGG No data
1178907807_1178907814 21 Left 1178907807 21:36650846-36650868 CCTCTGGAGGATGTGGCAACATG No data
Right 1178907814 21:36650890-36650912 CAGGCCCTCTGTGAGTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178907807 Original CRISPR CATGTTGCCACATCCTCCAG AGG (reversed) Intergenic
No off target data available for this crispr