ID: 1178907812

View in Genome Browser
Species Human (GRCh38)
Location 21:36650871-36650893
Sequence CCATCTTGGGAGTGGAGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178907807_1178907812 2 Left 1178907807 21:36650846-36650868 CCTCTGGAGGATGTGGCAACATG No data
Right 1178907812 21:36650871-36650893 CCATCTTGGGAGTGGAGACCAGG No data
1178907806_1178907812 3 Left 1178907806 21:36650845-36650867 CCCTCTGGAGGATGTGGCAACAT No data
Right 1178907812 21:36650871-36650893 CCATCTTGGGAGTGGAGACCAGG No data
1178907802_1178907812 25 Left 1178907802 21:36650823-36650845 CCATGTGAGACATGGCGTTCGTC No data
Right 1178907812 21:36650871-36650893 CCATCTTGGGAGTGGAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178907812 Original CRISPR CCATCTTGGGAGTGGAGACC AGG Intergenic
No off target data available for this crispr