ID: 1178908304

View in Genome Browser
Species Human (GRCh38)
Location 21:36654081-36654103
Sequence CTGTGTGCCCACATGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178908304_1178908307 -2 Left 1178908304 21:36654081-36654103 CCTGGGTCCATGTGGGCACACAG No data
Right 1178908307 21:36654102-36654124 AGTAGGCATTCAATAACTGTTGG No data
1178908304_1178908308 14 Left 1178908304 21:36654081-36654103 CCTGGGTCCATGTGGGCACACAG No data
Right 1178908308 21:36654118-36654140 CTGTTGGTTGAATAAATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178908304 Original CRISPR CTGTGTGCCCACATGGACCC AGG (reversed) Intergenic
No off target data available for this crispr