ID: 1178909161

View in Genome Browser
Species Human (GRCh38)
Location 21:36660337-36660359
Sequence ATGAGCGCCCTGTTGTGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178909161_1178909165 9 Left 1178909161 21:36660337-36660359 CCAATCCACAACAGGGCGCTCAT No data
Right 1178909165 21:36660369-36660391 GTCCACCTGAGAGTCCACGAGGG No data
1178909161_1178909164 8 Left 1178909161 21:36660337-36660359 CCAATCCACAACAGGGCGCTCAT No data
Right 1178909164 21:36660368-36660390 TGTCCACCTGAGAGTCCACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178909161 Original CRISPR ATGAGCGCCCTGTTGTGGAT TGG (reversed) Intergenic