ID: 1178910340

View in Genome Browser
Species Human (GRCh38)
Location 21:36668836-36668858
Sequence GCCGAGGAGGTGGGCACGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178910340_1178910350 0 Left 1178910340 21:36668836-36668858 CCCACCGTGCCCACCTCCTCGGC No data
Right 1178910350 21:36668859-36668881 TTCCCAGCTGCGGTGGCCCAGGG No data
1178910340_1178910346 -10 Left 1178910340 21:36668836-36668858 CCCACCGTGCCCACCTCCTCGGC No data
Right 1178910346 21:36668849-36668871 CCTCCTCGGCTTCCCAGCTGCGG No data
1178910340_1178910349 -1 Left 1178910340 21:36668836-36668858 CCCACCGTGCCCACCTCCTCGGC No data
Right 1178910349 21:36668858-36668880 CTTCCCAGCTGCGGTGGCCCAGG No data
1178910340_1178910353 3 Left 1178910340 21:36668836-36668858 CCCACCGTGCCCACCTCCTCGGC No data
Right 1178910353 21:36668862-36668884 CCAGCTGCGGTGGCCCAGGGAGG No data
1178910340_1178910348 -7 Left 1178910340 21:36668836-36668858 CCCACCGTGCCCACCTCCTCGGC No data
Right 1178910348 21:36668852-36668874 CCTCGGCTTCCCAGCTGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178910340 Original CRISPR GCCGAGGAGGTGGGCACGGT GGG (reversed) Intergenic
No off target data available for this crispr