ID: 1178918464

View in Genome Browser
Species Human (GRCh38)
Location 21:36722789-36722811
Sequence GCCACCCCTGAGGCCCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 321}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178918464_1178918473 26 Left 1178918464 21:36722789-36722811 CCATCAGGGGCCTCAGGGGTGGC 0: 1
1: 0
2: 4
3: 42
4: 321
Right 1178918473 21:36722838-36722860 CAAGGAAGCCACACCAGGACTGG 0: 1
1: 0
2: 1
3: 18
4: 203
1178918464_1178918471 21 Left 1178918464 21:36722789-36722811 CCATCAGGGGCCTCAGGGGTGGC 0: 1
1: 0
2: 4
3: 42
4: 321
Right 1178918471 21:36722833-36722855 AGAGCCAAGGAAGCCACACCAGG 0: 1
1: 0
2: 1
3: 20
4: 254
1178918464_1178918468 8 Left 1178918464 21:36722789-36722811 CCATCAGGGGCCTCAGGGGTGGC 0: 1
1: 0
2: 4
3: 42
4: 321
Right 1178918468 21:36722820-36722842 GCTGCCTTCCTTTAGAGCCAAGG 0: 1
1: 1
2: 1
3: 21
4: 184
1178918464_1178918474 27 Left 1178918464 21:36722789-36722811 CCATCAGGGGCCTCAGGGGTGGC 0: 1
1: 0
2: 4
3: 42
4: 321
Right 1178918474 21:36722839-36722861 AAGGAAGCCACACCAGGACTGGG 0: 1
1: 0
2: 1
3: 25
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178918464 Original CRISPR GCCACCCCTGAGGCCCCTGA TGG (reversed) Intronic
900265734 1:1756113-1756135 GCCAGCACTGAGGCCCATGGTGG - Intronic
900356489 1:2267548-2267570 GCCAGGCCTGAGGGCACTGAGGG + Intronic
900488140 1:2933189-2933211 TGCACCCCCGAGGCCCCAGAGGG - Intergenic
900990776 1:6097212-6097234 CCCACCACAGGGGCCCCTGATGG - Intronic
901426309 1:9183829-9183851 GCCTCCTCTCAGGCCCCCGAGGG - Intergenic
901550127 1:9989857-9989879 GCAACCCCTGAAGCCCCAGAAGG - Intergenic
901868420 1:12123315-12123337 GCCACCCCTGGGGACCCAGCCGG + Exonic
902575495 1:17374718-17374740 GCCACTCCTGAGGGTCCTGGAGG - Intronic
902943194 1:19815019-19815041 ACCACCGCTGTGGCCCCTGCTGG - Exonic
903014415 1:20352683-20352705 GCCACATCTGGGGCCCCTCAGGG + Intronic
903045814 1:20563436-20563458 ACCACCCCTGAGGCCCATCATGG - Intergenic
903072991 1:20737092-20737114 GTTTCTCCTGAGGCCCCTGAGGG - Intergenic
904334099 1:29785815-29785837 GTCACCTCTCAGGCCCCTGCTGG + Intergenic
904447559 1:30587288-30587310 GCCTGCTCTGAGGTCCCTGAGGG + Intergenic
904477933 1:30776671-30776693 GCCACCCCTGAGCCACTTGGTGG + Intergenic
904756146 1:32769961-32769983 GCCGCCCCCGAGGCACCTCAGGG + Exonic
905168945 1:36098779-36098801 GGCTCCCCTTTGGCCCCTGATGG + Exonic
905860830 1:41350045-41350067 GCCACCCCTGTGGCTCCACAGGG + Intergenic
906231466 1:44168815-44168837 GCCAGTCCTCAGGCCCTTGATGG + Intergenic
907838355 1:58132605-58132627 GCCACCCCTGAAGGAGCTGAAGG + Intronic
909183123 1:72450009-72450031 GCCTGTCCTCAGGCCCCTGATGG - Intergenic
911725682 1:101238888-101238910 ACCACCCCTGAAGCCAGTGAAGG + Exonic
912582130 1:110730214-110730236 GCAACCCCTGAAGCCCCAGAAGG - Intergenic
912722055 1:112028547-112028569 ACCAGCACTGAGTCCCCTGAGGG - Intergenic
913531273 1:119735919-119735941 GCCCACCCCGAGGACCCTGAGGG - Intronic
913536678 1:119779562-119779584 GCCTCTCATGAGGCCCCCGAAGG - Intergenic
914331004 1:146670927-146670949 GCAATCCCTGAAGCCCCAGAGGG + Intergenic
914827451 1:151146038-151146060 GACCCTCCTGACGCCCCTGAAGG - Intronic
915273992 1:154775577-154775599 CCCACCCATGAGGATCCTGAAGG + Intronic
915339023 1:155166392-155166414 GCCAGCCCGGAGGTCCCTGAGGG + Intergenic
915674282 1:157515945-157515967 GCCAGCCCTGAGCCTCCTGGAGG + Intronic
915838505 1:159197184-159197206 CCCACCACTGGGGTCCCTGAGGG + Intronic
917438383 1:175044136-175044158 GTCACTCCTGTGGCCCCAGAGGG - Intergenic
918878661 1:190084668-190084690 GAGAGCCCTTAGGCCCCTGAGGG + Intergenic
919165364 1:193885263-193885285 GTCCTTCCTGAGGCCCCTGAGGG + Intergenic
919903177 1:202058795-202058817 GCCTCACCTCTGGCCCCTGAGGG - Intergenic
920013728 1:202888798-202888820 TCCGCCCCTGGGGCCGCTGAAGG - Intronic
922504975 1:226121288-226121310 GCCGCCCCTGAGGCCCCGCGTGG - Intergenic
922897997 1:229115304-229115326 CCCACCCCTGAGTCCCCAGCAGG - Intergenic
923397830 1:233584451-233584473 GCAATCCCTGAAGCCCCAGAAGG - Intergenic
923701153 1:236301624-236301646 ACAACCCCTGAAGCCCCAGAAGG - Intergenic
923944227 1:238864703-238864725 GTGACCCCTGAAGCCCCAGAGGG + Intergenic
924193284 1:241578499-241578521 GCCACACTTGAGGCCACTGTGGG + Intronic
924798787 1:247311868-247311890 GTCACCCCTGAAGCCCTAGATGG - Intronic
1065794309 10:29292114-29292136 GCCACCCCTGAGTGCGGTGAGGG - Intronic
1065965812 10:30769516-30769538 GCCATGCCTGAGACCCCTCATGG - Intergenic
1066668059 10:37806106-37806128 GCAACCCATGTGTCCCCTGATGG - Intronic
1066974152 10:42349509-42349531 GCCTCTACTGTGGCCCCTGAAGG + Intergenic
1068178050 10:53487263-53487285 GCAACTCCTGAAGCCCCAGAGGG + Intergenic
1069838268 10:71323019-71323041 GCCACCGGGGAGGACCCTGAGGG + Exonic
1073785054 10:106879839-106879861 GCCTCCCCAGAGCCCCCAGATGG + Intronic
1074645697 10:115449577-115449599 ACAACCCCTGAAGCCCCAGAGGG - Intronic
1074741051 10:116484688-116484710 ACCACACCTGAGCCCCATGACGG + Intergenic
1075024435 10:118974101-118974123 GCCACCCATGCTGTCCCTGAAGG - Intergenic
1075093485 10:119456388-119456410 GCCAGCCCAGGGGCCTCTGAAGG + Intronic
1075306678 10:121374268-121374290 TCCACCCCTAAGGCACCAGAAGG + Intergenic
1075888102 10:125919595-125919617 GCCAGCCCTGAGGCTCATGGTGG + Intronic
1076174379 10:128355993-128356015 GCAGCCCATGAGGCCCTTGAAGG + Intergenic
1076617755 10:131767948-131767970 TCCACGCCTTAGGCCCCTGACGG + Intergenic
1076686712 10:132201439-132201461 GCAACACCTGTGTCCCCTGAAGG - Intronic
1076743046 10:132497556-132497578 GCCACCCCTGGGGCCCCTTGGGG - Intergenic
1077380583 11:2235169-2235191 GCAGCCCAGGAGGCCCCTGAAGG + Intergenic
1077486641 11:2841773-2841795 GGCGCCCCTGAGGCCCTTGGGGG + Intronic
1077497799 11:2894926-2894948 GCCCACCCGGAAGCCCCTGAAGG - Intronic
1078934858 11:15941503-15941525 GCCTCCCCGGAGGGCCCTCACGG + Intergenic
1081969068 11:47186032-47186054 GCCCGCCCCGAGGCCCCAGAGGG - Intronic
1082076926 11:47981440-47981462 GCCGCCCCTCGGGCCCCTGCAGG - Intronic
1082729033 11:56772448-56772470 GCTTCCCCTGCGACCCCTGAAGG - Intergenic
1082813291 11:57491689-57491711 GGCACCGCTGAGGCCCCTGGGGG - Intronic
1082922645 11:58512187-58512209 GACTCCCCTGTGGCCCCTAAGGG - Intergenic
1083231877 11:61326878-61326900 GCCGCCCCTGAGGGTCCTGGGGG + Exonic
1083272525 11:61579650-61579672 TGCAGCCCTGAGGCTCCTGAAGG - Intronic
1083278213 11:61609338-61609360 GGCACCCCTCAGGCCGCTGCAGG + Intergenic
1083300447 11:61737330-61737352 GCCAACTCTGAAGCCCCAGATGG - Intronic
1083802159 11:65053101-65053123 GCCATGCCTGAGGGCCCTGGGGG - Intronic
1084166867 11:67379198-67379220 GGCACCACTGGGGCCCCCGAGGG + Intronic
1084406439 11:68976710-68976732 ACTCCCCCTGAGGCCCCTGCGGG - Intergenic
1086369436 11:86141715-86141737 GGCATCCCTCAGGCCCCTGCCGG + Intergenic
1088768446 11:113008989-113009011 GACACCCCTGAGGCCCCCATGGG - Intronic
1091590714 12:1841400-1841422 GCAAGTCCTGAGGCTCCTGAAGG + Intronic
1096679062 12:53242701-53242723 GCCTCCCCCACGGCCCCTGAAGG + Intergenic
1097499774 12:60388032-60388054 GACAACCCTTAGGCCTCTGAAGG - Intergenic
1097692045 12:62742710-62742732 TCCAGGCCTGAGGCCCCAGAAGG - Intronic
1100994371 12:100287111-100287133 GCCACCTCTGGTGCCTCTGAGGG + Intronic
1102677458 12:114668302-114668324 GCCGCCCCAGAGGCCACTCAGGG - Intergenic
1102950118 12:117025801-117025823 GCCATCCCTGAGGACCTGGATGG - Intronic
1103575290 12:121872787-121872809 GCCAACCCTGAGTCAGCTGAAGG + Intergenic
1103831569 12:123783821-123783843 CCCACCCCTGAAGACCCTGAAGG + Intronic
1104987682 12:132606114-132606136 GGCACCCCTGATGCCCCTGCAGG - Intronic
1105460552 13:20581612-20581634 TCCACCCCTGAGCCTCCTAAAGG - Intronic
1107911074 13:45106365-45106387 GCAACCCCTGAAGCTCCAGAGGG + Intergenic
1108248640 13:48542734-48542756 GCAACCCCTGAAACCCCAGAGGG - Intergenic
1108316599 13:49242968-49242990 GCAACCCCTGAAGCCCCAGAGGG - Intergenic
1108798804 13:54067495-54067517 GCCACCCCTGACGTCCCAAAGGG - Intergenic
1109184404 13:59251944-59251966 GAGACCCCTGGGGCCCCAGAGGG + Intergenic
1109793456 13:67279334-67279356 GCAACCCCTGAAGCCCCAGAAGG - Intergenic
1109864286 13:68242562-68242584 GCCACCAAAGTGGCCCCTGAGGG + Intergenic
1109864359 13:68243449-68243471 GCCACCAAAGAGGCCCCTGAGGG - Intergenic
1111461966 13:88556801-88556823 GCTACCCCTGTGGTCCTTGAGGG - Intergenic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1116396405 14:44452475-44452497 ACGACCCCTGAAGCCCCAGAAGG + Intergenic
1117390387 14:55256750-55256772 GCAACTCCTGAAGCCCCAGAGGG - Intergenic
1118071471 14:62250859-62250881 GCAACCCCTGAGGTCCCAGTTGG - Intergenic
1119738377 14:76998590-76998612 GCTGCCTCTGAGCCCCCTGAAGG + Intergenic
1122788838 14:104176044-104176066 TACACCTCTCAGGCCCCTGAGGG + Exonic
1122811478 14:104291474-104291496 GCCGCCCCAGGGACCCCTGAAGG - Intergenic
1123039600 14:105485100-105485122 GGGACCCCAGAGACCCCTGATGG + Intergenic
1123075263 14:105664768-105664790 CCCACCCCTCAGGGCACTGAGGG + Intergenic
1124601577 15:31136946-31136968 GACAACCCTGAGACCCCTGCAGG + Intronic
1126212143 15:46111756-46111778 GTGACCCCTGAAGCCCCAGAGGG - Intergenic
1126782592 15:52151233-52151255 TCCACACCTGGAGCCCCTGATGG + Intronic
1127763597 15:62164509-62164531 GCCACCCCCGCGGCCCCCGGCGG - Exonic
1128548898 15:68585020-68585042 GCCCCCGCAGAGGCCCCTGGAGG + Intronic
1129019527 15:72503899-72503921 GCAACCCCTGAAGCCCTAGAGGG + Intronic
1129147585 15:73662908-73662930 GCAACCTCTGAAGCCCCAGAAGG + Intergenic
1129695657 15:77739411-77739433 GCAGCCCCTGAGGCCCCCAAGGG - Intronic
1132375023 15:101323229-101323251 GCCACCTGTGGGGGCCCTGAGGG - Intronic
1133320237 16:4909141-4909163 CCCACTCCTGGGGCCCCTGCAGG + Intronic
1136343862 16:29663099-29663121 GGCACCCCGCTGGCCCCTGAAGG + Intronic
1136618260 16:31411351-31411373 GCCACCCCTGGGGCCGCTTTGGG + Exonic
1137531554 16:49281671-49281693 GGCACCCCTGAGGCCCGGGAGGG - Exonic
1139754530 16:69132240-69132262 CCCACCCCGGAGGCCCCTCCGGG + Intronic
1140002549 16:71039977-71039999 GCAATCCCTGAAGCCCCAGAGGG - Intronic
1140550146 16:75856549-75856571 GCAACCCCTGATGCCCCAGAGGG - Intergenic
1141095431 16:81159696-81159718 GCCAACCGTGAGGTCCCTGCCGG + Intergenic
1141656729 16:85420697-85420719 GCCACCCCTGAGAGTGCTGACGG - Intergenic
1142668282 17:1474893-1474915 GCCTCCCCGCAGGCCCCTGTGGG + Intronic
1144132457 17:12259967-12259989 GGCCCCCCTTAGACCCCTGAAGG - Intergenic
1146185640 17:30722507-30722529 ACCATCCCTGAGGCCTCTGGAGG - Intergenic
1146886714 17:36475695-36475717 GTGACCCCTGAAGCCCCAGAGGG + Intergenic
1147557055 17:41486307-41486329 GACACCCCTGTGGCTCCTGGAGG - Exonic
1147564240 17:41527110-41527132 CCTACCCCTCAGGCCCCTTAGGG + Intronic
1148567382 17:48641716-48641738 GCCGCCCCTGCCGCCCCTGTGGG - Intergenic
1149237316 17:54607460-54607482 GCTACACCTGAAGCCCCAGAGGG - Intergenic
1151429338 17:74051840-74051862 TCCACCGCAGAGGCCCCTGGGGG + Intergenic
1152363411 17:79842555-79842577 TCCTCTCCTGGGGCCCCTGAGGG - Intergenic
1152623169 17:81376015-81376037 GGCACCCTGGAGACCCCTGAGGG - Intergenic
1152637509 17:81436154-81436176 CCCACCTCTGAGGACCCAGAGGG - Intronic
1153843709 18:9030091-9030113 GCGACCCCTGAAGCCCCAGAAGG + Intergenic
1154054988 18:11004175-11004197 GACACCCCTGAGGACTGTGAGGG + Intronic
1156549853 18:38004094-38004116 GCCACCACTCAAACCCCTGAGGG - Intergenic
1156911593 18:42417271-42417293 GCTACCCCTGAAACCCCAGAGGG + Intergenic
1159726616 18:71968086-71968108 GTGACCCCTGGGGCCCCAGAGGG - Intergenic
1160265091 18:77335338-77335360 CCCTCCCCTGAGGCTGCTGAGGG - Intergenic
1160857920 19:1225732-1225754 GCCATCCCCGAGGCCCCTCCCGG - Intronic
1161258721 19:3323734-3323756 TGCACCCCTGTGGCCCCTGCTGG + Intergenic
1161459110 19:4386022-4386044 TCCTCTCCTGAGGCCTCTGATGG - Intronic
1161539959 19:4844641-4844663 GCCACCCCCCAGTCCCCTCATGG + Intronic
1162923672 19:13918919-13918941 CCCACCCCCGAGGACCCTGCTGG + Exonic
1162973139 19:14193213-14193235 ACCATCCCTGAGGCCTCTGGAGG + Intronic
1163517247 19:17772477-17772499 GACACACCTGAGGCACATGAAGG + Exonic
1163586647 19:18168006-18168028 GCCCTCCCTGAGGCCCAAGAGGG - Intronic
1163782163 19:19256345-19256367 GGCAGCCATCAGGCCCCTGATGG + Exonic
1164527434 19:29022442-29022464 GCCACCCCTGAGGGCCTTCCTGG + Intergenic
1164614151 19:29656108-29656130 GCCCTCCCTGAGGCCTCTGGAGG - Intergenic
1165107185 19:33477521-33477543 GCCACCTCTGTGGGCCCTGGAGG - Intronic
1165306421 19:35005495-35005517 ACCACCCAGGAGGACCCTGATGG + Intronic
1165423092 19:35732083-35732105 GCCATCCCGGAGGCCCTTGGGGG + Exonic
1165431527 19:35775939-35775961 GCCACCCAAGTGGCCCCTGCAGG + Intronic
1165652957 19:37507171-37507193 GCCACCACTGAGGCCCCGCGAGG - Intronic
1166312457 19:41970352-41970374 GCCACCCTTGGGGCCCAGGAGGG - Intronic
1166359595 19:42247676-42247698 CCCACCCCAGAGGCCCCAGCTGG + Exonic
1166733685 19:45072155-45072177 GCCGCCCCAGAGCCCCCTCATGG - Exonic
1166816461 19:45549298-45549320 GCCACCCCTGACGCCGCAGTGGG + Intronic
1167646877 19:50710749-50710771 GCAGCCCCCGTGGCCCCTGAAGG - Intronic
1168311182 19:55461592-55461614 GCCACCGCTGAGGCCTCTTGCGG + Exonic
1168352662 19:55685651-55685673 TCCCTCCCTGCGGCCCCTGACGG + Intronic
925017781 2:544808-544830 GCCCCTCCTGAGGCCCCTCCTGG + Intergenic
925196517 2:1930334-1930356 GGCACCCCTGTGGTCCCTGTGGG + Intronic
925265341 2:2563012-2563034 CCCACCCCAGAGGCCCGTGGAGG - Intergenic
925706281 2:6686856-6686878 GCGACCCCTGGAGCCCCAGAGGG + Intergenic
926121775 2:10245168-10245190 GGCAACCCTGAGGCACCTGTCGG + Intergenic
926562668 2:14434853-14434875 GTGACCCCTGAAGCCCCAGAGGG + Intergenic
926593100 2:14760349-14760371 GCCACCTCTGAGGCCGCAGTGGG - Intergenic
930515468 2:52402065-52402087 GCGACCCCTGAAGCCTCAGAGGG - Intergenic
931055242 2:58461939-58461961 TCCAACCCTTTGGCCCCTGATGG - Intergenic
932274235 2:70439817-70439839 GCAGGCCCTGAGGACCCTGAGGG - Intergenic
932731624 2:74226007-74226029 GCCAGCTCTGAGGCCCCTGAGGG + Intronic
933165500 2:79070456-79070478 GTGACCCCTGAAGCCCCAGAGGG - Intergenic
933250599 2:80024721-80024743 GCGACCCCTGGAGCCCCAGAGGG + Intronic
933747977 2:85584585-85584607 GCCTCCCCTGGGGCCCACGAGGG + Intronic
934183607 2:89650701-89650723 GCCAGCCCTCAGGCTCCTGGTGG + Intergenic
937292950 2:120793121-120793143 GCCCCTGCTGAGGCCCCAGAGGG + Intronic
937377377 2:121346657-121346679 GCCACCACTGATGCCCATGAGGG + Intronic
937905529 2:127051072-127051094 GGCTCCCCTGTGGCCCCTGCTGG - Intronic
937905569 2:127051221-127051243 GCCACCTCCGAGGCCTCTGCTGG + Exonic
937958910 2:127439564-127439586 GCCAGCCATGAGGACCCTGCTGG - Intronic
938150658 2:128879685-128879707 GTGACCCCTGAAGCCCCAGAAGG + Intergenic
938582657 2:132661171-132661193 GCTATTCCTGAGGCCCCTGTTGG - Intronic
938942433 2:136180898-136180920 GTGACCCCTGAAGCCCCAGAAGG + Intergenic
940862702 2:158787143-158787165 GCGACCCCTGAAGCCCCAAAGGG + Intergenic
943969622 2:194386605-194386627 GTGACCCCTGAAGCCCCAGAAGG - Intergenic
944001421 2:194842956-194842978 ACAACCCCTGAAGCCCCGGAGGG - Intergenic
944840637 2:203620611-203620633 CCCACACCTGAGGCCCCAGGGGG - Intergenic
945174096 2:207023945-207023967 GCCACTCCTCAGGCCCCTGGAGG - Intergenic
946563693 2:220940645-220940667 GCGACCCCTGAAGCCCCAGAGGG - Intergenic
948232840 2:236364632-236364654 CCCACACCTGAGGCCCCTTCTGG - Intronic
948458944 2:238119919-238119941 GCCACCACTGGGGCCTCTGTTGG + Intronic
948642709 2:239385667-239385689 GCCACCCCAGGAGCCCCAGAAGG + Intronic
1172599462 20:36173862-36173884 ACCACCCCTGTGACCCCTGCAGG + Exonic
1172700770 20:36852358-36852380 GCCGCCCCTGTGGCCACTGCCGG - Intronic
1173851716 20:46222736-46222758 GCCATCCCTGTCGCCCCTGTGGG + Intronic
1174398824 20:50264881-50264903 GCCACCCCAGTGGGCCCTGCTGG + Intergenic
1175641262 20:60632490-60632512 GCCTCCCCTGACTCCTCTGATGG + Intergenic
1175741137 20:61420436-61420458 CCCACCCCTGGGGACCCTGTGGG - Intronic
1175938346 20:62525496-62525518 GCCACCCCTGACGCAGATGAGGG + Intergenic
1176010076 20:62888549-62888571 GCCACACCTGAGGGTGCTGATGG - Intronic
1176285237 21:5015928-5015950 GCCACACTTGTGGCCCCTGCAGG + Intergenic
1176415983 21:6475060-6475082 GCCACCCCTCAGGCTCCTCCTGG - Intergenic
1177420070 21:20844855-20844877 GTCACCACTGAGGAGCCTGAGGG - Intergenic
1177491470 21:21831133-21831155 GCAACCCCGGAAGCCCCAGAGGG - Intergenic
1178918464 21:36722789-36722811 GCCACCCCTGAGGCCCCTGATGG - Intronic
1179502321 21:41818003-41818025 GCCACACCTGGGTCCCCTGCAGG - Intronic
1179691483 21:43083394-43083416 GCCACCCCTCAGGCTCCTCCTGG - Intergenic
1179871944 21:44247547-44247569 GCCACACTTGTGGCCCCTGCAGG - Intronic
1179987579 21:44930158-44930180 TCCACCCAGGAAGCCCCTGAAGG + Intronic
1180159097 21:45991142-45991164 GCCACCCGTGCGGCCTCAGAGGG + Intronic
1181064351 22:20298697-20298719 CCCACCCCTCAGGCCTCTTAGGG - Intergenic
1182104699 22:27681093-27681115 GGCAGCCCTGGGGTCCCTGAAGG + Intergenic
1183129654 22:35821823-35821845 TCCTCTCCTGAGGCCGCTGAAGG + Intronic
1183475291 22:38032837-38032859 GCCACCCCTCCTGCCCCTGCAGG - Intronic
1183606846 22:38871310-38871332 GCCCCCCCAGAAGCCCCTGATGG - Intronic
1184098542 22:42329639-42329661 GCCACCCAGGAGGCCACTGCAGG + Intronic
1184402431 22:44281856-44281878 ACCACTCCTGACGCCCCTGCTGG + Intronic
1184445033 22:44542098-44542120 CCCACCACTGGGGCCCATGAGGG + Intergenic
1184517412 22:44971219-44971241 GCCACGCCAGGGGCCCATGATGG - Intronic
1184598358 22:45527768-45527790 GCCTCCCCTGAGGCCTCTCGTGG + Intronic
1184710512 22:46246869-46246891 CCCACCCCAGTGGCCCCTCAGGG - Intronic
1185087760 22:48749858-48749880 GCCACTCCCGGGGCCCCTCAGGG - Exonic
949956620 3:9274512-9274534 GTGACCCCTGAAGCCCCAGAAGG + Intronic
950473950 3:13204103-13204125 GTTACCCCTGCGGCCCATGAAGG - Intergenic
951651785 3:24959055-24959077 GCAATCCCTGAAGCCCCAGAGGG + Intergenic
952973998 3:38678827-38678849 GCCAACTCTGTGACCCCTGAGGG + Intergenic
953058163 3:39404923-39404945 GCCAAGGCTGAGGCCCCTGGAGG + Intergenic
953734100 3:45476510-45476532 GCCACCCCTGAAGCCATTTATGG + Exonic
953918101 3:46933433-46933455 GCCTACCCAAAGGCCCCTGAGGG + Intronic
954133844 3:48573041-48573063 GAGACCCCTGTGGACCCTGACGG + Exonic
954650969 3:52162490-52162512 GTCCTCCCTGGGGCCCCTGAGGG + Intergenic
954680441 3:52343137-52343159 GCTACCCCTGAGGCCACTCCAGG - Intronic
957210139 3:77248504-77248526 GCGACCCCTGAAGCCCCAGACGG - Intronic
959212834 3:103410397-103410419 GCGACCTCTGAAGCCCCTGAGGG - Intergenic
959839511 3:110958550-110958572 GCCACTGCTGAAACCCCTGATGG + Intergenic
960505775 3:118491615-118491637 GCCATCCCTGCAGCCTCTGAAGG - Intergenic
961540057 3:127593266-127593288 GCCACCCCTGAGCCTGCTGTAGG - Intronic
962171363 3:133104830-133104852 TCCATCCCTCAGGCCCCTGCTGG + Intronic
962688104 3:137866831-137866853 GTCACCTCTGAGACCCCAGATGG - Intergenic
963451740 3:145490687-145490709 GCTACTCCTGAAGCCCCAGAGGG - Intergenic
965257028 3:166426097-166426119 GCCACCCCTCAGGCAACTGAAGG + Intergenic
966033342 3:175378104-175378126 GTGACCCCTGAAGCCCCAGAGGG - Intronic
967889227 3:194353281-194353303 GCCAGCCCGGGGGCCGCTGAGGG - Intergenic
968445539 4:650437-650459 GGGAGCCCTGAGGCCTCTGATGG - Intronic
968471935 4:786428-786450 TCCTCCGCGGAGGCCCCTGAGGG - Exonic
968902481 4:3438186-3438208 GCCACCCCATAGGCGCCTCAAGG + Intronic
969309892 4:6347039-6347061 GCCATCCCAGAGGCCCCTGAAGG - Intronic
969495541 4:7524128-7524150 GTCACCCCTGAGGTTCCTGGTGG - Intronic
971791750 4:31178099-31178121 GTCACCCCTTTGGCCGCTGAAGG + Intergenic
972251657 4:37308908-37308930 GCCAGTCCTTAGGCCCCTGATGG + Intronic
972483111 4:39516593-39516615 GCCAGACCTATGGCCCCTGAAGG - Intronic
975947352 4:79723791-79723813 GCCACCCATGAAGCCCCAGAGGG + Intergenic
978593922 4:110356331-110356353 ACGACCCCTGAAGCCCCAGAAGG - Intergenic
979184396 4:117770713-117770735 ACAACCCCTGAAGCCCCAGAGGG - Intergenic
983697826 4:170554351-170554373 GCCACCCCCAAGGCCCCGGAGGG + Intergenic
984292037 4:177807985-177808007 GCGACCCCTGAAGCCCCAGAAGG + Intronic
985048857 4:185970083-185970105 GCAACCCCTGAAGCCCCAGAGGG + Intergenic
985643417 5:1074202-1074224 GCCCCCGCCGAGGCCCCTGAGGG + Intronic
985714062 5:1445870-1445892 GCCACCGTAGGGGCCCCTGATGG - Intergenic
985776870 5:1848912-1848934 GCCACAGCGCAGGCCCCTGAGGG + Intergenic
986163151 5:5249656-5249678 GCGACCCCTGGAGCCCCAGAGGG + Intronic
986778717 5:11044900-11044922 GCCACCACTGGGGACCCTGAGGG + Intronic
988231334 5:28483615-28483637 GCGACCCCTGAAGCCCCAGAGGG + Intergenic
993274824 5:85843797-85843819 GCAACCCCTGACGCCCCAGAGGG + Intergenic
994145219 5:96387428-96387450 TCCACCTCTGAGACACCTGATGG + Intergenic
994188041 5:96837618-96837640 GCAACTCCTGAAGCCCCAGAAGG + Intronic
995420676 5:111963142-111963164 GTGACCCCTGAAGCCCCAGAGGG - Intronic
996052153 5:118947211-118947233 GTGACCCCTGAAGCCCCAGAGGG + Intronic
997305087 5:132830686-132830708 GCCTCCCCTGAGGCCGCGGCCGG - Exonic
997350936 5:133230941-133230963 GCCGCCCCTGAAGCCACTGCAGG - Intronic
997596020 5:135107954-135107976 GCCACCCTTGAGGGTCCTGCGGG + Intronic
999730809 5:154475750-154475772 GCCACTCCTGAAGCCCCGGGAGG - Exonic
1000410838 5:160934051-160934073 CCTACCCCTGTGGCCCCTGAAGG - Intergenic
1000866241 5:166518408-166518430 ACGACCCCTGAAGCCCCAGAGGG + Intergenic
1003257676 6:4488482-4488504 GCCTACTCTGAGGCTCCTGATGG - Intergenic
1004647164 6:17573686-17573708 GCCAACCCCAAGGCCCCAGAGGG + Intergenic
1004977477 6:20984423-20984445 GAGACCCCTGAAGCCCCAGAAGG + Intronic
1007344473 6:41217599-41217621 GCCACCCCCCAGGGACCTGAAGG - Intergenic
1007345867 6:41229076-41229098 GCCACCCCCCAGGGACCTGAAGG + Intronic
1007631531 6:43275738-43275760 CCCACCACTGAGGGCCCTGGGGG + Intronic
1007752581 6:44079462-44079484 GCCACCCCTGAGGCTCCCCAGGG - Intergenic
1008255754 6:49297655-49297677 GCAACCCCTAAAGCCCCAGAAGG + Intergenic
1009627023 6:66147028-66147050 GCAACCCCTGAAGCCCCAGAGGG + Intergenic
1010057587 6:71584761-71584783 GCCACCACCCAGGCCCCAGAAGG - Intergenic
1010736647 6:79450961-79450983 GAGACCCCTGAAGCCCCAGAGGG - Intergenic
1013316872 6:108951691-108951713 GCCACACCCGACGCCCCTCACGG + Intronic
1015240552 6:131018347-131018369 GCCACCACTGAGACCTCTAAAGG + Intronic
1015440422 6:133241224-133241246 GCCTCCCCCGAGGCCCCCGGCGG + Intronic
1016569059 6:145492373-145492395 GCCACCCCCAAGGCCCCTGAGGG + Intergenic
1017727472 6:157285532-157285554 CCCACCCCGGGGACCCCTGAAGG + Intergenic
1018906196 6:168077601-168077623 GCAACTCCTGTGGCCCCTGCTGG - Intronic
1018915422 6:168129750-168129772 GCCACCCCTGACCCCCGTGGTGG - Intergenic
1019295545 7:272172-272194 GCGGCACCTGAGGCCCCTGCAGG + Intergenic
1020110125 7:5443247-5443269 GTCACCCCTGTGGGCCCCGAGGG - Intronic
1021015441 7:15525864-15525886 TGCAACCCTGAGGCCCCAGAGGG - Intronic
1021033100 7:15763019-15763041 GTCACCCCTTTGGGCCCTGAAGG + Intergenic
1022591850 7:31671234-31671256 GCAACCCCTGAAGTCCCAGAAGG - Intergenic
1023824165 7:43997640-43997662 GCCATCCCTGTGGCCCCTCTGGG - Intergenic
1023840937 7:44097115-44097137 GCCACCCCTGAGGGCCTGGAGGG - Intergenic
1023873642 7:44275779-44275801 GCCCCCACTGAGCCCCCAGAAGG + Intronic
1026836738 7:73644750-73644772 TCCATCCCTGAGTCCCCTGGAGG - Intergenic
1029752430 7:102550969-102550991 GCCATCCCTGTGGCCCCTCTGGG - Intronic
1029770382 7:102650062-102650084 GCCATCCCTGTGGCCCCTCTGGG - Intronic
1030306661 7:108026042-108026064 GCCACCCCACAGGAGCCTGAGGG - Intronic
1030546850 7:110907081-110907103 ACGACCCCTGAAGCCCCAGAAGG + Intronic
1031782433 7:125985458-125985480 GTGACCCCTGAAGCCCCAGAGGG - Intergenic
1032248335 7:130231838-130231860 GCGACCCCTGAAGACCCAGAAGG + Intergenic
1032418097 7:131754264-131754286 GCTACCCTCGAGGCCGCTGAAGG - Intergenic
1032947574 7:136870387-136870409 GGCGCCCCTGGGGCCCCTCACGG + Intronic
1034092955 7:148381153-148381175 GCAACCCCTGAAGCCCCAGAGGG + Intronic
1035154053 7:156897945-156897967 ACCAGCCCAGAGGCCACTGAAGG - Intergenic
1035302460 7:157906474-157906496 GCCATACGTGAGGCCCATGAGGG + Intronic
1035363212 7:158327920-158327942 TGCACCCCTGGGGACCCTGATGG - Intronic
1035745418 8:1959200-1959222 GCCACCCTTCAAGCCTCTGATGG + Intergenic
1037258590 8:16982190-16982212 GCAACCCCTCAAGCCCCAGAGGG - Intergenic
1038062245 8:23926538-23926560 ACCAGCACTGAGACCCCTGAAGG + Intergenic
1042819690 8:72916506-72916528 GTAACCCCTGAAGCCCCAGAAGG + Intronic
1043103842 8:76083022-76083044 GCCACCCCCAAGACCCCAGAAGG - Intergenic
1043946008 8:86253400-86253422 GCCACAGCTGAGGCAACTGAGGG + Intronic
1044605700 8:94045569-94045591 GCAGCCCCTGCAGCCCCTGATGG + Intergenic
1045248638 8:100465030-100465052 GCCACACCTGTTGCCCCCGATGG - Intergenic
1046438765 8:114230932-114230954 GCAACTCCTGAAGCCCCAGAGGG - Intergenic
1047431615 8:124798189-124798211 CCCACCCCAGAGCCCCCTGGGGG - Intergenic
1048439645 8:134450534-134450556 ACAACCCCTGAAGCCCCAGATGG - Intergenic
1049243157 8:141548887-141548909 GCCACCTCTGAGGACCCTCGAGG - Intergenic
1049476505 8:142799461-142799483 GTAACCTCTGAGGCCCCTGGAGG + Intergenic
1049573668 8:143380950-143380972 GTCATCCCCCAGGCCCCTGAAGG - Intronic
1049743932 8:144255072-144255094 GCCACCCCACAGGCACCTGGAGG + Intronic
1050541405 9:6673659-6673681 GTGACCCATGAGGCCCATGAAGG + Intergenic
1053583851 9:39435970-39435992 GCAACCCCTGATGCCCCAGAAGG + Intergenic
1054105432 9:60994714-60994736 GCAACCCCTGATGCCCCAGAAGG + Intergenic
1054452142 9:65409006-65409028 GCCACCTCTGAGCCCACTGCCGG - Intergenic
1055375427 9:75644883-75644905 ACAACCCCTGAAGCCCCAGAGGG + Intergenic
1055376076 9:75649138-75649160 GCAACCCCTAAAGCCCCAGAGGG + Intergenic
1056752559 9:89363012-89363034 GCCTCACCTGAGGCACCTGTTGG - Intronic
1056956828 9:91089327-91089349 GGCACCCCTGAGGTCCTTCAGGG - Intergenic
1057276654 9:93679748-93679770 GCCACCCCTGCAGCCCCCGAGGG - Intergenic
1058884377 9:109312449-109312471 GCGACCCCTGAGCCCCCAAAGGG - Intronic
1059985108 9:119813812-119813834 GTGACCCCTGAAGCCCCAGAGGG - Intergenic
1060527017 9:124326505-124326527 GCTGCCCCTGAGGACCCTGGAGG - Intronic
1061052121 9:128203250-128203272 GACACCCATGATGCCCCGGACGG + Intronic
1061245243 9:129398275-129398297 TCCAGCCCTGATGCCCCTCAGGG - Intergenic
1061948273 9:133920822-133920844 GCCCCAACTGAGGTCCCTGAAGG + Intronic
1185480233 X:440806-440828 GCCGACCCTGAGGGCCCTGGAGG + Intergenic
1186486316 X:9936872-9936894 GCCACCCCTGAGGCATCCCAAGG - Intronic
1186590786 X:10927939-10927961 GCCCCCCATGAGGACCCTAAGGG - Intergenic
1187261979 X:17693278-17693300 GTCCCCACTGAGGCCCCAGAAGG - Intronic
1187324512 X:18274174-18274196 GTGACCCCTGAAGCCCCAGAGGG - Intronic
1188587232 X:31792759-31792781 GCGACCCCTGAAGCCCCAGAGGG + Intronic
1190125191 X:47698595-47698617 GCAACCCCTGAGGCCCCAGAGGG - Intergenic
1191052925 X:56213723-56213745 GTCACCCCAGAAGCCCCAGAAGG + Intergenic
1191057214 X:56254421-56254443 GCGACCCTTGAAGCCCCAGAAGG + Intronic
1192565508 X:72159998-72160020 GCCTCCGCTGAAGGCCCTGAGGG + Intergenic
1193027611 X:76861437-76861459 GCCACCCCAGTGGGCCCAGAAGG + Intergenic
1193810016 X:86040194-86040216 GCAACCCCTGAAGCTCCAGAGGG - Intronic
1195814609 X:108870996-108871018 GTCAACACTGAGGCCCCTGAGGG - Intergenic
1196395870 X:115261262-115261284 ATGACCCCTGAGGCCCCAGAGGG + Intergenic
1197340660 X:125263079-125263101 GTGACCCCTGATGCCCCAGAGGG + Intergenic
1199337082 X:146630728-146630750 GCAACCCCTGAAGCCCCAGAAGG - Intergenic
1200071163 X:153530178-153530200 GCCAGCCCTGGAGCCTCTGAAGG + Intronic
1201751462 Y:17436447-17436469 GCCACTCCTGAAGCCCCAGTGGG + Intergenic