ID: 1178919721

View in Genome Browser
Species Human (GRCh38)
Location 21:36730675-36730697
Sequence CCCCCGAAGCCCTCCAAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178919716_1178919721 12 Left 1178919716 21:36730640-36730662 CCACAATTTATAAAAAACATTCA 0: 1
1: 0
2: 8
3: 108
4: 997
Right 1178919721 21:36730675-36730697 CCCCCGAAGCCCTCCAAGAGTGG 0: 1
1: 0
2: 0
3: 13
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178919721 Original CRISPR CCCCCGAAGCCCTCCAAGAG TGG Intronic
900371784 1:2335474-2335496 CCCCTGAAGCCCTTCTAGGGCGG + Intronic
900584197 1:3424685-3424707 GCCCCCAAGCCCTCCATGAATGG + Intronic
903206251 1:21784481-21784503 ACCCCGAAGCCTCCCAAGACTGG - Intergenic
903325286 1:22565645-22565667 CCCCAGAGCCCCTCGAAGAGGGG + Intronic
904811245 1:33164709-33164731 CCCTCGAAGCCCTCCAGAGGTGG - Intronic
904877031 1:33663206-33663228 CCTCCGAAGCCCAGCAGGAGGGG + Intronic
905272001 1:36793424-36793446 CCCCACAAGCACTCCATGAGGGG + Intergenic
905372699 1:37493045-37493067 CCCAACAAGCCCTCCAAGAAAGG + Exonic
905684774 1:39900908-39900930 CTCCCCGAGCCATCCAAGAGGGG - Intronic
908617621 1:65940113-65940135 CTACGGAAGTCCTCCAAGAGAGG + Intronic
914824918 1:151133265-151133287 CCCCCGCCGCCCTCCAAGGACGG - Exonic
915585486 1:156841691-156841713 CCCCCGAGTCCCTCAAAGATGGG - Exonic
919905200 1:202073672-202073694 CCTCCAAAGCCTTCCAAGATGGG - Intergenic
1063415106 10:5866678-5866700 CCGCCGAAGCCATCAAAAAGGGG + Intronic
1064717300 10:18190093-18190115 CCCCCGAAGCCCTTCATGGGTGG + Intronic
1065956144 10:30695308-30695330 ACCCCTGAGCCCCCCAAGAGTGG - Intergenic
1069784073 10:70976950-70976972 CCACTGAAGGCCTCCAAAAGGGG + Intergenic
1069870942 10:71532536-71532558 CGGCAGAAGCCCTCCCAGAGGGG + Intronic
1069942537 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG + Intronic
1075050320 10:119178632-119178654 CCGCGGAAACCCTCCAAGAAGGG + Intronic
1076140886 10:128077794-128077816 AGCCCGAAGCCCTCCAGGTGGGG + Intronic
1076144040 10:128102844-128102866 CCCCCACTGCCCTTCAAGAGGGG - Exonic
1076806404 10:132861364-132861386 CCCCCGAAGACCAGCCAGAGTGG - Intronic
1078742678 11:14081814-14081836 CCCACGCAGCCCACCCAGAGGGG + Intronic
1083651887 11:64208838-64208860 GCCCCGAAGGCCTCCAGAAGGGG + Intronic
1084462863 11:69306056-69306078 CCCCCGGAGACCTCCCAGTGTGG + Intronic
1084470526 11:69356674-69356696 CCCCCGAAGACCTCCATGCTGGG + Intronic
1084712721 11:70853861-70853883 CCACTGAAGCACACCAAGAGAGG - Intronic
1091063710 11:132489249-132489271 CCCCTGAAGACCTCCCAGCGGGG - Intronic
1091651763 12:2315643-2315665 TCCCCCAAGCCCTTCAAGGGAGG - Intronic
1092365143 12:7871483-7871505 GACCCGAAGCCCTCAAAGGGAGG - Intronic
1094025893 12:25959106-25959128 CCCCCGCAGGCCGCCCAGAGGGG - Exonic
1097572770 12:61355264-61355286 CCCCCAGAGCCCTCCACGATGGG + Intergenic
1102044061 12:109818644-109818666 TCCCAGAAGCCCTACAAGGGAGG - Intronic
1112561111 13:100514974-100514996 TTCCCACAGCCCTCCAAGAGCGG - Intronic
1122327183 14:100889817-100889839 CGCCCAAAGCCCTCCCAGAGAGG - Intergenic
1124023844 15:25946493-25946515 CTGCCCAAGCCCTCCAAGACAGG + Intergenic
1124154256 15:27211173-27211195 CACCCAAGGCCCTCCAGGAGTGG + Intronic
1129067132 15:72914692-72914714 CCCAAGAAGACCTCCAAGTGGGG - Intergenic
1129158470 15:73733276-73733298 GCCCCGAACCCCTACCAGAGGGG - Intergenic
1129970127 15:79770953-79770975 CCCCCGAGGCTCTACCAGAGAGG - Intergenic
1135654437 16:24235355-24235377 CCCCAGAAACCCTACAAGAGAGG - Intergenic
1136479937 16:30534771-30534793 CCCCCGAAGGCCCACTAGAGGGG + Exonic
1137562214 16:49510229-49510251 CCACAGTAACCCTCCAAGAGGGG + Intronic
1137753110 16:50881099-50881121 CCTCCCAAGCCCACCCAGAGGGG - Intergenic
1137887166 16:52118130-52118152 CCTCCCAGGCCCTCCTAGAGAGG + Intergenic
1142205136 16:88779345-88779367 CCCCCGACGCCGTCCAAAATGGG - Intronic
1145121776 17:20266837-20266859 ACACCAAAGCCCTTCAAGAGAGG - Intronic
1145203263 17:20966343-20966365 ACACCAAAGCCCTTCAAGAGAGG - Intergenic
1146397776 17:32482519-32482541 CCCCCAAAGCCCTCCAAGTTTGG - Exonic
1148049802 17:44764259-44764281 CCCCAGAAGCCCTCCACGGTGGG + Intronic
1148149275 17:45386684-45386706 CCCCCTGTGTCCTCCAAGAGTGG - Intergenic
1160414409 18:78698111-78698133 CCCCCAAACCCCTCCAAGAAGGG - Intergenic
1160970716 19:1766619-1766641 CCCCCATCACCCTCCAAGAGGGG - Intronic
1163329434 19:16627504-16627526 CCCGGGAAGCCCTCCCGGAGCGG - Intronic
1163502024 19:17681836-17681858 CCCGAGGAGCGCTCCAAGAGGGG - Intronic
1163679345 19:18671638-18671660 CCCCCGCATCCCCCCAAGAAAGG + Exonic
1164456133 19:28408533-28408555 CCCCCGATGCCCCCGATGAGAGG - Intergenic
1164517495 19:28948545-28948567 CACCCCAAGGCCTCCCAGAGAGG - Intergenic
1165329202 19:35131935-35131957 CCGCCCCAGCCCTCCATGAGAGG - Intronic
1165830832 19:38729456-38729478 CCCCCGACGGCCTCCAGGAGGGG + Exonic
1168266510 19:55226665-55226687 CCCCCGAATCCCCCCACCAGAGG + Intronic
925147005 2:1588400-1588422 TCCCCAAAGCTCTCCAAGAGGGG + Intergenic
931075094 2:58702091-58702113 GCCACAAAGCTCTCCAAGAGAGG - Intergenic
932447767 2:71791266-71791288 CCCCTGAAGCCCTCCCAGCCAGG - Intergenic
935188609 2:100757334-100757356 TCCCCAAAGCCCACCAGGAGTGG + Intergenic
937733337 2:125260671-125260693 CCAAGGAAGCCTTCCAAGAGTGG + Intergenic
944067368 2:195633409-195633431 CCCCTGAAGCCCCAGAAGAGTGG + Intronic
946397640 2:219451350-219451372 CCCCCGGACTCCTCCAAGGGAGG + Intronic
948014189 2:234674379-234674401 CCCCTTAAGGTCTCCAAGAGAGG - Intergenic
1168819159 20:761717-761739 CCCCAGTGGCCCTGCAAGAGGGG + Exonic
1169072035 20:2738642-2738664 CCCCAGCTGCCCACCAAGAGTGG - Intronic
1169218343 20:3806149-3806171 CCCCAGAAGCCCGCCAATGGCGG + Intergenic
1171010772 20:21508399-21508421 CCTCCGAAGCCATCAAAGACAGG + Intergenic
1172623332 20:36333733-36333755 GCCTCGAAGCCCTTCAAGGGTGG + Intronic
1174693662 20:52535419-52535441 CCCCCGACTTCCTCCAAGGGTGG + Intergenic
1175677952 20:60962757-60962779 CCACTGTGGCCCTCCAAGAGAGG - Intergenic
1176426356 21:6550966-6550988 CCCCCGAGGCCCTCCGAGGCTGG - Intergenic
1178919721 21:36730675-36730697 CCCCCGAAGCCCTCCAAGAGTGG + Intronic
1179701847 21:43159283-43159305 CCCCCGAGGCCCTCCGAGGCTGG - Exonic
1182279428 22:29209285-29209307 CCCCCAGAGGCCTCCAGGAGGGG - Intronic
1185324241 22:50217884-50217906 CCCCCGCAGCCCTCCCAGCCAGG + Intronic
1185330834 22:50251432-50251454 GCCCCGATCCCCTCCAAGAGGGG + Intronic
953904629 3:46862276-46862298 TCCCAGCAGCCCTGCAAGAGGGG + Intronic
954375304 3:50191403-50191425 TCCCCGCAACCCTCCAGGAGAGG - Intergenic
960302516 3:116021093-116021115 ACCCAGAGGCCCTACAAGAGTGG - Intronic
962732265 3:138294296-138294318 ACCCTGAAGCCCTCCAAGCCTGG - Intronic
962919933 3:139941582-139941604 CCCCCGAAGCCTTGCAGGAAAGG + Intronic
969704478 4:8784413-8784435 GCCCCTACTCCCTCCAAGAGGGG - Intergenic
969729401 4:8944987-8945009 CTGCCAAAGCCCTCCAACAGGGG - Intergenic
971512621 4:27445953-27445975 GCTCCGAAGCCCTCCCAGAGAGG + Intergenic
972714054 4:41628139-41628161 CCCACAAGGCCCTCCAAGAATGG - Intronic
976239226 4:82935801-82935823 CCTCCGAAGCCCTGCTACAGAGG + Intronic
977693811 4:99946341-99946363 GCCCCGCAGGCCTCCAGGAGGGG + Intronic
979099771 4:116599638-116599660 CCCCCTATGGCCTCCAGGAGGGG + Intergenic
994201367 5:96979858-96979880 CCCCCGAAGCCCTTCTAGCAGGG + Exonic
995462409 5:112418622-112418644 GCCCCGCAGCTCTCAAAGAGGGG - Intronic
998082951 5:139292206-139292228 CCCGCCAAGGCCTCCAAAAGTGG + Intronic
998091784 5:139375288-139375310 CCCCTGAAACCCTCCAGCAGAGG + Intronic
998452223 5:142243896-142243918 TCTCCTAAGCCCTCCAAGATAGG - Intergenic
1002001101 5:176196640-176196662 CCACTCAAGCCCTCCAAGGGTGG - Intergenic
1002253234 5:177942332-177942354 CCACTCAAGCCCTCCAAGGGTGG + Intergenic
1015085487 6:129285762-129285784 CCCCAAAATCCCTTCAAGAGAGG - Intronic
1018017715 6:159727270-159727292 CCGCCGAACCCCGCCAGGAGAGG - Exonic
1018621602 6:165734243-165734265 TCCCCGAAGCCCACCCAGTGTGG - Intronic
1019996028 7:4725050-4725072 CCCCCGAGGCCATCCAAGCGCGG + Intronic
1024047709 7:45596438-45596460 ACCCAGAAGCCCTCCCAGACTGG - Intronic
1027238896 7:76314485-76314507 CCCCTGGTGCCCTCCCAGAGAGG + Intergenic
1028454329 7:91021991-91022013 CCACAGAAGCCCACAAAGAGGGG + Intronic
1030563768 7:111124664-111124686 CCCCAGAAGGCCTCCAAGACAGG - Exonic
1031608282 7:123794951-123794973 CCCCTGAAGGCACCCAAGAGTGG + Intergenic
1031978036 7:128106047-128106069 CACCTGAAGCCTTCCAGGAGGGG - Intergenic
1037844970 8:22275275-22275297 TCCCCGGAGGCCTCGAAGAGCGG + Exonic
1039479160 8:37858867-37858889 CCCCCCACCCCCACCAAGAGAGG + Intronic
1049830534 8:144698881-144698903 CCCCCCAACCCCCCCAAGGGAGG - Intergenic
1054832953 9:69646537-69646559 CCTCCGAAGCTCTCCAGAAGGGG - Intronic
1056246580 9:84701509-84701531 CCCCCTAAGCCCTCCAATATAGG - Intronic
1057850602 9:98564262-98564284 CTCCCGAAGGCCTCTAAGAGTGG - Intronic
1060483157 9:124029867-124029889 CCCCAGAGGCCCTCAGAGAGAGG - Intronic
1061162190 9:128901919-128901941 CCCCCGAAGCCCCATCAGAGAGG + Intronic
1062110199 9:134778055-134778077 CCCCAGAACCCCACCAAGAAGGG - Intronic
1062425846 9:136505871-136505893 CCCTCGAAGCCCTGCCCGAGAGG + Exonic
1188777454 X:34238444-34238466 CCCCTGAAGCCCTTCCAGTGGGG - Intergenic
1189007465 X:37010193-37010215 CCCCCGGAGCCCCCCGAGACTGG + Exonic
1189007517 X:37010409-37010431 CCCCCGGAGCCCCCCGAGACTGG + Exonic
1189041216 X:37543387-37543409 CACCCGGAGCCTTCCAAGACTGG - Intronic
1189519406 X:41750413-41750435 CCCCAGAAGCACCCCAAGATGGG - Intronic
1189986953 X:46562016-46562038 CCCCCACTGCCCTTCAAGAGGGG - Intergenic
1190541769 X:51484610-51484632 GCCCCGCAGCACCCCAAGAGAGG + Intergenic
1198283852 X:135171025-135171047 CCCCAGAAGCCTCCCAATAGGGG - Intronic
1200001703 X:153065482-153065504 ACCCCGGAGTCCTCCAGGAGAGG + Intergenic
1200067697 X:153512083-153512105 CCCCTGCAGCCCTCCAAGGAGGG - Intergenic