ID: 1178922540

View in Genome Browser
Species Human (GRCh38)
Location 21:36747965-36747987
Sequence GGTCGCCGCCTCGGGGCCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 1, 2: 3, 3: 15, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178922540_1178922546 -5 Left 1178922540 21:36747965-36747987 CCGGCGGCCCCGAGGCGGCGACC 0: 1
1: 1
2: 3
3: 15
4: 138
Right 1178922546 21:36747983-36748005 CGACCGGCGCGCTGCGGCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 64
1178922540_1178922553 27 Left 1178922540 21:36747965-36747987 CCGGCGGCCCCGAGGCGGCGACC 0: 1
1: 1
2: 3
3: 15
4: 138
Right 1178922553 21:36748015-36748037 CCCGCCGCCACCTCCCCGCCCGG 0: 1
1: 3
2: 10
3: 81
4: 767

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178922540 Original CRISPR GGTCGCCGCCTCGGGGCCGC CGG (reversed) Exonic
900637174 1:3671653-3671675 GCTCGCCCTCTCGGGGCCTCTGG + Intronic
903180186 1:21601436-21601458 GGTCCCCGCCTCACGGCCGCAGG - Intronic
903504720 1:23825325-23825347 GGCCGCCGCCTCGGCGGCTCGGG + Intronic
903986895 1:27234979-27235001 GGTCCCCGCCTCGGCGCCCGCGG - Intronic
904244987 1:29181494-29181516 TGGCGGCGCCTCGGGGGCGCGGG - Intronic
905789771 1:40783910-40783932 GCTCGGAGCCTGGGGGCCGCCGG - Intergenic
905867135 1:41382459-41382481 TGCCGCCGCCGCCGGGCCGCTGG + Exonic
906027147 1:42682965-42682987 GGTCGGCGGCGCGCGGCCGCAGG - Intronic
910183168 1:84506720-84506742 GCTCTCCGCCTCGGGTCAGCGGG - Intergenic
915367103 1:155322826-155322848 GCTCCCCCCCTCGGGGTCGCCGG + Exonic
917974171 1:180229003-180229025 GCTCGACGCCTCCGGGCTGCAGG - Intergenic
921190063 1:212700399-212700421 AGCCGCGGCTTCGGGGCCGCTGG - Intergenic
1065342708 10:24722784-24722806 AGCCGCCTCCTCGGGGACGCCGG - Intronic
1065342905 10:24723428-24723450 GGGCGCTGGCTCGGGGCCGGAGG - Intronic
1072253703 10:93601139-93601161 GGCCGGGGCCTCGGGGCCGGCGG - Intronic
1072408982 10:95183546-95183568 CCTCGCCTCCTCCGGGCCGCGGG + Intergenic
1072770724 10:98135043-98135065 GGTTACCCCCTCGGGGCTGCGGG + Intronic
1073136926 10:101225369-101225391 GGGTCCCGCCTCCGGGCCGCTGG - Intergenic
1076374234 10:129972834-129972856 CGCGGCCGCCTGGGGGCCGCGGG + Intergenic
1076670045 10:132115387-132115409 GGAGGCCTCCTCTGGGCCGCTGG - Intronic
1077018322 11:406681-406703 GCTCCCCGCATCGGGGCCCCAGG + Intronic
1077245457 11:1534912-1534934 GGTGGCCGCCTCGAGGCTGGAGG + Intergenic
1077253753 11:1571806-1571828 GGGCGCCGCGTCGGGGGCGCTGG - Intronic
1083995344 11:66268898-66268920 GGTCGCCACGTCTGGGCCCCGGG - Intronic
1084151271 11:67289062-67289084 GGGCGCCTCCTGCGGGCCGCGGG + Intronic
1089694919 11:120211071-120211093 CGTCTCCGCCTCGGGGCCGCCGG + Exonic
1094199229 12:27780135-27780157 GGCCGCCGCCTCGCGGGAGCGGG + Exonic
1096098956 12:48957338-48957360 GGCCGCCGCCTCTGCCCCGCAGG + Exonic
1097664918 12:62467218-62467240 CTTCACCGCCTCGGGGCTGCTGG - Exonic
1101910476 12:108857368-108857390 GGACGCCGCGCCGAGGCCGCCGG - Intronic
1103514703 12:121500059-121500081 GGGCGCCCCCTGGTGGCCGCAGG - Intronic
1112328279 13:98458550-98458572 AGTGGCCGCCTCGGGGCCGGCGG - Intronic
1113775602 13:112943386-112943408 GGTCCCCGGCTCCGCGCCGCAGG + Intronic
1115120029 14:29927761-29927783 GGCAGCCGGCTCGGGGCCGCCGG + Intronic
1119219371 14:72893602-72893624 GGCCGCGGGCTCGGGGGCGCGGG + Intronic
1120713226 14:87814686-87814708 GTTAGCCGTCTCTGGGCCGCCGG + Intergenic
1121453962 14:94026811-94026833 GGGCGCCGCCTCGACGGCGCTGG + Intronic
1122693289 14:103541492-103541514 GGCCTCTGTCTCGGGGCCGCCGG + Intergenic
1125999255 15:44194571-44194593 GGCCGCCCCGTCGGGGGCGCAGG - Intronic
1127103187 15:55588056-55588078 GGACGAGGCCTCGGGGCGGCGGG + Intronic
1127753481 15:62068132-62068154 GGCGGCAGCCGCGGGGCCGCCGG - Exonic
1127867187 15:63042501-63042523 GGCCGCCGCCTCGGCGGCTCGGG + Intergenic
1128161046 15:65422977-65422999 GGGCGCGGCCTCGGGGGCCCGGG + Exonic
1128547882 15:68579676-68579698 GCTGGCCTCCTCGGGGCGGCAGG - Intronic
1128865940 15:71115369-71115391 GGTCGCCGCCAGGGGGCGGCAGG + Exonic
1129780036 15:78264238-78264260 GGGGGCGGCCTCGGGGCGGCGGG + Exonic
1130613432 15:85381163-85381185 GGTCCCCGGGTCGGCGCCGCCGG + Intronic
1131484611 15:92809422-92809444 GCTCGCAGCCTCAGGGACGCCGG - Intronic
1133164834 16:3939072-3939094 GGACGCCGCGTGGGGGACGCTGG + Intergenic
1133223758 16:4330466-4330488 GGTCGCCACCAGGGGGCAGCTGG - Intronic
1134143606 16:11742762-11742784 CGCCGCCGCCTCGGGCCCGAAGG + Exonic
1135135773 16:19884732-19884754 CGTCGGCGCTGCGGGGCCGCGGG - Exonic
1135607368 16:23836125-23836147 GGTGCCGGCCCCGGGGCCGCGGG - Exonic
1136409946 16:30070277-30070299 GGCCGCCTCCTCGGGGCTCCAGG + Exonic
1136630890 16:31488728-31488750 GGTCGCCGGCGCGTGGCCGCAGG - Exonic
1137673725 16:50293554-50293576 GGAGGCCGCCTGGGGGCCGGTGG - Intronic
1137714817 16:50592229-50592251 TGCCGCCGCCTGGGGGCTGCTGG + Intronic
1138229030 16:55324385-55324407 TCTCGCCTCCTCCGGGCCGCAGG + Exonic
1139489659 16:67279508-67279530 GGACACCGCCTCCTGGCCGCTGG - Exonic
1140096969 16:71883835-71883857 CCTCGCCCCCTCGCGGCCGCCGG - Intronic
1141079206 16:81035960-81035982 CGCCGCCGCCTCGGGCCCGTGGG + Exonic
1141972454 16:87492764-87492786 CGTCGCCGCCTGGGGAGCGCTGG + Intergenic
1142170886 16:88622224-88622246 GGCTGCCACCACGGGGCCGCAGG + Exonic
1142426933 16:90006463-90006485 GGTAGCCGGCCCGGGGCAGCGGG + Exonic
1142513154 17:410519-410541 GGGCGGCGCCGCGGGCCCGCGGG + Exonic
1142623535 17:1179394-1179416 GGTCCCCGCCCCCGGACCGCAGG + Intronic
1142799632 17:2337280-2337302 GCTCTCAGCCGCGGGGCCGCGGG + Exonic
1143554426 17:7651671-7651693 GGGCGACGCCTCGGGGGCGCAGG + Intronic
1144340794 17:14309240-14309262 GATCGCCGCCTCTGGCCCGGGGG + Intronic
1144519586 17:15945058-15945080 GGGTGCCGCCTCTTGGCCGCGGG + Exonic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1151854387 17:76710749-76710771 GGCCGCCGGCTCGGGGGCGCAGG + Exonic
1152068851 17:78125477-78125499 GGTCCCCGACTCGGGGCCCAGGG + Intronic
1152222137 17:79074799-79074821 AGTCCCCGCCGCGCGGCCGCTGG + Intergenic
1153893035 18:9535823-9535845 GGACGCCGTCTCTGGGCGGCTGG - Exonic
1156171728 18:34493945-34493967 GGGCGGCGCCTCAGGCCCGCGGG + Intronic
1158259090 18:55588069-55588091 GAACGCCGCCTCGGCGCCGGCGG - Intronic
1161755906 19:6134172-6134194 GGTCTCCACCTCGTGGCCTCAGG - Intronic
1163138647 19:15331960-15331982 GGGCGCCGCGGCGGGGCCGGCGG - Intronic
1163547295 19:17947972-17947994 GGGCGGGGCCGCGGGGCCGCCGG + Intergenic
1165065720 19:33226809-33226831 GGGGGCCGCGTCGGGGCCACCGG + Intergenic
1167268250 19:48493882-48493904 GGGCGCGGCGGCGGGGCCGCGGG - Exonic
1168282064 19:55311290-55311312 GGTCTCCGCCACGGGACCTCAGG + Intronic
925009183 2:468930-468952 GTTCCCCGCTTCAGGGCCGCAGG - Intergenic
926268271 2:11344960-11344982 GGGTTCCGCCTCGGGGCCGCGGG - Intronic
926581404 2:14634854-14634876 AGTAGCCGCCTAGGGGCTGCCGG + Exonic
927168583 2:20350324-20350346 GGCCGCCGCCTCGGGGGCGTGGG - Intronic
929501159 2:42493055-42493077 GGGAGCCGCCTCGGCCCCGCCGG + Exonic
934515295 2:94982380-94982402 GATCCCGGCCTCGGGGCCACTGG + Intergenic
934846371 2:97663709-97663731 CGTCGCCCCCGCCGGGCCGCTGG - Intronic
937261162 2:120587435-120587457 GGGCGCCCCCTCGGGGCCGCGGG - Intergenic
941104895 2:161341129-161341151 GGCCGCCGGCTCGGGGGCGCAGG + Intronic
941112124 2:161427191-161427213 GCTCGAGGCCGCGGGGCCGCGGG + Intronic
943692288 2:190881189-190881211 GTCCCCCGCCTCGGGGACGCCGG - Exonic
945404018 2:209423833-209423855 GGTCCCCGCCTGGCGGCCGGCGG + Intergenic
948047138 2:234952796-234952818 GGTCCCCGCCCGCGGGCCGCCGG - Intronic
948438066 2:237967226-237967248 CGGGGCCGCCTCGGGCCCGCCGG + Intronic
948645349 2:239400806-239400828 GGACGCGGCCACGGCGCCGCCGG + Exonic
948993181 2:241564793-241564815 GGTGTCTGTCTCGGGGCCGCTGG + Intronic
1169131406 20:3168010-3168032 GCTCGCCGCCTCGGGGCGCCTGG - Intronic
1169220593 20:3820253-3820275 CGGCGCCCCCTCGCGGCCGCCGG + Intergenic
1171997044 20:31739488-31739510 GGTCGCCGCCTAGGCGGGGCAGG + Exonic
1173729181 20:45316862-45316884 GGTGGCGGGCTCGGGGACGCCGG - Exonic
1175269009 20:57720562-57720584 GCTTGCAGCCTCGGAGCCGCTGG - Intergenic
1178922540 21:36747965-36747987 GGTCGCCGCCTCGGGGCCGCCGG - Exonic
1178992129 21:37365971-37365993 GGTGCCAGCCTCAGGGCCGCCGG + Intronic
1180010129 21:45043902-45043924 TGATGCCGCCTGGGGGCCGCTGG - Intergenic
1180959380 22:19755698-19755720 GGACGCGGCCTCGGGGTCTCGGG - Intergenic
1181032427 22:20154970-20154992 GGGCGCCCCCTCAGGGCCACTGG - Intergenic
1181035511 22:20168126-20168148 GGTAGCGGCGTGGGGGCCGCAGG - Intergenic
1181094350 22:20495608-20495630 GGTCGCCGCCCCCGAGCCTCCGG + Intronic
1181510987 22:23388626-23388648 GGGCGCCCCCTCGGGGCCACTGG + Intergenic
1181941904 22:26484033-26484055 GAACTCCGCCTCGGGGCCCCGGG - Exonic
1184035258 22:41915001-41915023 GGAGGCCGCGCCGGGGCCGCGGG + Intergenic
1184046770 22:41976902-41976924 GGGCGGCGCGGCGGGGCCGCGGG + Exonic
1184796887 22:46738016-46738038 GGGCGCCGGCTCCGGGCCCCGGG + Exonic
952644475 3:35639292-35639314 TGTCGCCGCCTCTGCGCCACTGG - Intronic
961081561 3:124033038-124033060 GGAGGCCGGCGCGGGGCCGCTGG + Intergenic
961585118 3:127915664-127915686 GGGCGCCGACCCGGGGCCACCGG + Intronic
962807494 3:138937932-138937954 GGTCAGCGCTTCGGCGCCGCCGG + Intergenic
967596259 3:191329445-191329467 GGTGGCCGCGGCGGGGCAGCTGG + Exonic
968640565 4:1712462-1712484 GGGCGAGGCCTCGGGACCGCGGG + Exonic
968652876 4:1767079-1767101 GGTCTCCCAGTCGGGGCCGCAGG - Intergenic
969452322 4:7281689-7281711 GATGGCAGCCTGGGGGCCGCAGG + Intronic
974716016 4:65669688-65669710 CGCCGCCGCTTGGGGGCCGCCGG + Exonic
979685318 4:123505647-123505669 GGTCGCGGCCTCGGCGGCGGCGG - Intergenic
985782038 5:1876574-1876596 GGTCGCCTCCTCGCCGCCCCCGG + Intergenic
987050470 5:14143766-14143788 GGCCGCCGCGGCGGGGCCGGAGG - Exonic
995106310 5:108381226-108381248 GGCCGCCGCCTGGGAGCAGCAGG - Exonic
997585098 5:135039306-135039328 GGTAGCAGCCTCGGGGGCACGGG - Intronic
999300046 5:150485658-150485680 GGTCACCGCCTCGGGGACGCCGG + Intergenic
1000296337 5:159916377-159916399 GGTGGCGGCGTCGGGGCTGCGGG + Intergenic
1002133602 5:177095594-177095616 GGTCGGGGCCTGGGGGGCGCCGG - Exonic
1002771183 6:292123-292145 GGACCCCGGCTCGCGGCCGCCGG - Intronic
1005704232 6:28435660-28435682 GGAGGCCTCCTCAGGGCCGCTGG + Intronic
1006008386 6:31021138-31021160 GGATCCCGCCCCGGGGCCGCAGG - Intronic
1013459017 6:110358009-110358031 GGGCGCCGCCGGGGGGCGGCGGG - Exonic
1014230213 6:118894612-118894634 GTTCGGCGCCTGGCGGCCGCGGG + Intronic
1019088295 6:169502082-169502104 GGCAGCCGCCCCGGGGCTGCGGG + Intronic
1024579854 7:50793044-50793066 GGGCGTCGCCTCCGGGCCGGGGG - Intronic
1037961956 8:23104420-23104442 TGTTGCCGCCTAGGGGCAGCTGG + Intronic
1041449797 8:57994648-57994670 GGTCGCCGCCGCGGGGCCGCGGG - Exonic
1049788457 8:144462424-144462446 GGGCGGCGCGTCGGGGTCGCCGG + Intronic
1054255025 9:62802503-62802525 CATCGCCACCCCGGGGCCGCGGG + Intergenic
1057463774 9:95292427-95292449 CGCCGCCGCCTCGGGCCCGTGGG + Intronic
1060407556 9:123380409-123380431 GGTCTCTGCCTCGGGGAAGCAGG - Exonic
1061000518 9:127899667-127899689 GGGCGGAGCCTCGGGGCCGCGGG + Intronic
1061015975 9:127980933-127980955 GGCTGCAGCGTCGGGGCCGCAGG - Intergenic
1061095814 9:128456335-128456357 GGTCGACCCCGCGGGGCCGTCGG + Intronic
1062008086 9:134251559-134251581 GCTCCCGGCCCCGGGGCCGCTGG + Intergenic
1062363193 9:136197255-136197277 GGTGGGCGGCTCGGGGCTGCTGG - Exonic
1062507590 9:136886117-136886139 GGTCTCCGCCCCGGGGCCACGGG + Intronic
1062653531 9:137590429-137590451 CGCCGCCGCCTCGCGCCCGCCGG + Exonic
1186669855 X:11757919-11757941 GGGCGCAGCCTGGAGGCCGCGGG + Intergenic
1187950419 X:24465324-24465346 GATCTCGGCCTCGGCGCCGCCGG - Intronic
1200001010 X:153059711-153059733 GGTGGCCGCCTCTGGGCCCAAGG + Intronic
1200141941 X:153906836-153906858 TGTCCCAGCCTCGGGGCCACAGG - Exonic
1200239484 X:154486368-154486390 CTTCGCCGTCTGGGGGCCGCGGG - Intronic