ID: 1178922988

View in Genome Browser
Species Human (GRCh38)
Location 21:36751549-36751571
Sequence CTGTGCACCCGCACCCCAGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178922977_1178922988 16 Left 1178922977 21:36751510-36751532 CCCCCAGAGGCTGCGCTCTGTGG 0: 1
1: 0
2: 1
3: 32
4: 264
Right 1178922988 21:36751549-36751571 CTGTGCACCCGCACCCCAGTCGG 0: 1
1: 0
2: 0
3: 12
4: 101
1178922982_1178922988 -7 Left 1178922982 21:36751533-36751555 CCTGTGCTCCCCCGACCTGTGCA 0: 1
1: 0
2: 2
3: 14
4: 207
Right 1178922988 21:36751549-36751571 CTGTGCACCCGCACCCCAGTCGG 0: 1
1: 0
2: 0
3: 12
4: 101
1178922979_1178922988 15 Left 1178922979 21:36751511-36751533 CCCCAGAGGCTGCGCTCTGTGGC 0: 1
1: 0
2: 2
3: 39
4: 384
Right 1178922988 21:36751549-36751571 CTGTGCACCCGCACCCCAGTCGG 0: 1
1: 0
2: 0
3: 12
4: 101
1178922981_1178922988 13 Left 1178922981 21:36751513-36751535 CCAGAGGCTGCGCTCTGTGGCCT 0: 1
1: 0
2: 3
3: 36
4: 289
Right 1178922988 21:36751549-36751571 CTGTGCACCCGCACCCCAGTCGG 0: 1
1: 0
2: 0
3: 12
4: 101
1178922980_1178922988 14 Left 1178922980 21:36751512-36751534 CCCAGAGGCTGCGCTCTGTGGCC 0: 1
1: 0
2: 1
3: 29
4: 280
Right 1178922988 21:36751549-36751571 CTGTGCACCCGCACCCCAGTCGG 0: 1
1: 0
2: 0
3: 12
4: 101
1178922976_1178922988 26 Left 1178922976 21:36751500-36751522 CCTTGGGGGACCCCCAGAGGCTG 0: 1
1: 0
2: 1
3: 34
4: 298
Right 1178922988 21:36751549-36751571 CTGTGCACCCGCACCCCAGTCGG 0: 1
1: 0
2: 0
3: 12
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178922988 Original CRISPR CTGTGCACCCGCACCCCAGT CGG Exonic