ID: 1178922988

View in Genome Browser
Species Human (GRCh38)
Location 21:36751549-36751571
Sequence CTGTGCACCCGCACCCCAGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178922980_1178922988 14 Left 1178922980 21:36751512-36751534 CCCAGAGGCTGCGCTCTGTGGCC 0: 1
1: 0
2: 1
3: 29
4: 280
Right 1178922988 21:36751549-36751571 CTGTGCACCCGCACCCCAGTCGG 0: 1
1: 0
2: 0
3: 12
4: 101
1178922981_1178922988 13 Left 1178922981 21:36751513-36751535 CCAGAGGCTGCGCTCTGTGGCCT 0: 1
1: 0
2: 3
3: 36
4: 289
Right 1178922988 21:36751549-36751571 CTGTGCACCCGCACCCCAGTCGG 0: 1
1: 0
2: 0
3: 12
4: 101
1178922979_1178922988 15 Left 1178922979 21:36751511-36751533 CCCCAGAGGCTGCGCTCTGTGGC 0: 1
1: 0
2: 2
3: 39
4: 384
Right 1178922988 21:36751549-36751571 CTGTGCACCCGCACCCCAGTCGG 0: 1
1: 0
2: 0
3: 12
4: 101
1178922976_1178922988 26 Left 1178922976 21:36751500-36751522 CCTTGGGGGACCCCCAGAGGCTG 0: 1
1: 0
2: 1
3: 34
4: 298
Right 1178922988 21:36751549-36751571 CTGTGCACCCGCACCCCAGTCGG 0: 1
1: 0
2: 0
3: 12
4: 101
1178922977_1178922988 16 Left 1178922977 21:36751510-36751532 CCCCCAGAGGCTGCGCTCTGTGG 0: 1
1: 0
2: 1
3: 32
4: 264
Right 1178922988 21:36751549-36751571 CTGTGCACCCGCACCCCAGTCGG 0: 1
1: 0
2: 0
3: 12
4: 101
1178922982_1178922988 -7 Left 1178922982 21:36751533-36751555 CCTGTGCTCCCCCGACCTGTGCA 0: 1
1: 0
2: 2
3: 14
4: 207
Right 1178922988 21:36751549-36751571 CTGTGCACCCGCACCCCAGTCGG 0: 1
1: 0
2: 0
3: 12
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178922988 Original CRISPR CTGTGCACCCGCACCCCAGT CGG Exonic
900534480 1:3170259-3170281 CTCTGCACCCCCACCCCGGAAGG - Intronic
900550382 1:3251544-3251566 CTGTGCACCCTGACCCCTGCAGG - Intronic
900655940 1:3757066-3757088 CTGTCCATCCTCACCCCAGTGGG + Intronic
900675793 1:3885163-3885185 CTGTGCACCCGCCACCCACACGG - Exonic
901480330 1:9520625-9520647 CTGTGCAGACGCAGCCCAGAAGG - Intergenic
904422477 1:30403163-30403185 CTGCCCACCCTCACCCCAGCTGG + Intergenic
908326560 1:63029110-63029132 CTGCTCACCTGCACCCCAGCTGG - Intergenic
914692644 1:150044522-150044544 GTGTGCACCACCACCCCAGGTGG - Intergenic
914802013 1:150968768-150968790 CTGTGCACCCCCTCCCCTGAAGG - Intronic
915355693 1:155254357-155254379 CTGGGCACCTGCCTCCCAGTGGG + Intronic
917543165 1:175935248-175935270 CTGTGCAACTGCACTCCAGCAGG + Intergenic
921707840 1:218344963-218344985 GTGTGCACACGCACCCCTATGGG - Intergenic
922339379 1:224643439-224643461 CTTTGGCCCCGCAGCCCAGTCGG + Intronic
1064010022 10:11728145-11728167 CTCTGCAGCCCCACCCCAGCAGG - Intergenic
1067093462 10:43283590-43283612 CTGGGCAGCCTCATCCCAGTGGG - Intergenic
1068724984 10:60290760-60290782 CTGTGCACAGACACCCCAGCAGG - Intronic
1068886936 10:62107824-62107846 TTGTGCCACCGCACTCCAGTGGG - Intergenic
1069588782 10:69629617-69629639 CTGTGGACCTGCTCACCAGTGGG - Intergenic
1076353235 10:129832821-129832843 CCGTGCCACCCCACCCCAGTTGG - Intergenic
1076628258 10:131834822-131834844 CTGTGTACCCACACCCCCATGGG + Intergenic
1081374555 11:42343556-42343578 CTGTGAAACCGGACCCCAGCTGG + Intergenic
1082031256 11:47605668-47605690 CTGTGCTCCTTCACCCCAGTTGG - Intergenic
1082125003 11:48422042-48422064 TTGTCCACCTGCACCCCAGAGGG - Intergenic
1084095242 11:66907032-66907054 CTGTGCTCCAGCTCCCCAGCCGG - Intronic
1084516983 11:69642673-69642695 CCGCGGCCCCGCACCCCAGTTGG + Intronic
1087094654 11:94307350-94307372 CTTTGCACCTGCACCCTTGTGGG - Intronic
1088326799 11:108609129-108609151 CTCTTCACACCCACCCCAGTGGG + Intergenic
1088441016 11:109870311-109870333 CTGTGCTCCCGCTCCCTAGAGGG + Intergenic
1089342338 11:117766840-117766862 CTCTGCACTTGCACGCCAGTTGG - Intronic
1091915498 12:4269845-4269867 CTGTGCATCCGCACTCCCTTCGG - Intergenic
1103362741 12:120363317-120363339 CTGTGCACCCACACCCTGGCTGG + Intronic
1104802997 12:131567382-131567404 CTGTCCACCGGCACACCAGCTGG + Intergenic
1106009348 13:25803579-25803601 CTGTGCACACGCACGAGAGTTGG - Intronic
1113946647 13:114048353-114048375 CACTGCACCCCCACCCCATTGGG + Intronic
1119621320 14:76134123-76134145 CTGGGCAGGGGCACCCCAGTGGG - Intergenic
1120701861 14:87706801-87706823 CTGTGCCTCCCCACCCCCGTAGG + Intergenic
1122100750 14:99407787-99407809 CTGTGCACCTGCCTCCCCGTCGG + Intronic
1122721502 14:103724942-103724964 CTGCCCACCCGCTCCCCAGCAGG - Intronic
1122824303 14:104362214-104362236 CTGCCCACCCACTCCCCAGTAGG - Intergenic
1122930549 14:104931356-104931378 CTGTCCACCCCCACCCCCGTGGG - Intronic
1127828233 15:62725119-62725141 AGGTACACCCGCACCCCAGCTGG - Intronic
1128538921 15:68511448-68511470 CTGTTCACCCACATCCCATTTGG - Intergenic
1128543277 15:68551417-68551439 CTCTTCACCCACAGCCCAGTGGG - Intergenic
1129470297 15:75750031-75750053 CTGGGCACCCCCAGCCCAGAGGG + Intergenic
1129720472 15:77875241-77875263 CTGTGCCCACCCACCCCAGCCGG - Intergenic
1131068094 15:89447225-89447247 CTGTACATGCCCACCCCAGTGGG + Intergenic
1136240996 16:28943983-28944005 CTGTGCCCCTGCTCCCCAGCTGG + Intergenic
1138554580 16:57764110-57764132 CTGTGAACCCCCACCCCATTGGG + Intronic
1138588448 16:57986127-57986149 GCGTCCACCCCCACCCCAGTGGG - Intronic
1141962458 16:87418410-87418432 CAGTGCACACGCACCCCCATAGG - Intronic
1142165643 16:88586037-88586059 CTGTGCACCCGAGTCCCTGTGGG + Intronic
1144797066 17:17899185-17899207 CTATGTACCCACACACCAGTGGG - Intronic
1148149990 17:45391285-45391307 CTGTGAGCCCACAGCCCAGTGGG + Intergenic
1148848543 17:50542858-50542880 CTGTGCAATCGCACTGCAGTGGG - Exonic
1149602777 17:57904067-57904089 CTGGGCAGCCAGACCCCAGTGGG + Intronic
1151585416 17:75005410-75005432 CTCTGCACCGGGATCCCAGTGGG + Exonic
1152595675 17:81236514-81236536 CTGCCCACCCTCACCCCAGCTGG - Intronic
1152698315 17:81806986-81807008 GTGTGCACCCCCAACCCAGAGGG - Intronic
1154156460 18:11947917-11947939 CTGTGCACCCCCACCCCAACCGG + Intergenic
1156108158 18:33690952-33690974 CTGTGCTACCTCACCCCACTTGG + Intronic
1158250798 18:55485330-55485352 CCCTCCACCAGCACCCCAGTAGG + Intronic
1159593141 18:70356657-70356679 CTGGGGACCCTCACCCCTGTAGG + Intergenic
1162000955 19:7744871-7744893 CTGAGCACCTCCTCCCCAGTTGG + Intronic
1162004221 19:7766855-7766877 CTGAGCACCTCCTCCCCAGTTGG - Intronic
1163641843 19:18466538-18466560 CTGTGCCCCTGCAGCCCAGCTGG + Intronic
926017086 2:9463017-9463039 CTGAGCACCTGCTCCCCAGCAGG + Intronic
926326002 2:11785574-11785596 GTGTGCCCACGCCCCCCAGTGGG + Intronic
927860973 2:26559687-26559709 CTCTGTACCCGCACCCCAGCTGG + Intergenic
938263176 2:129909575-129909597 CTGTCCACCCCCACCCCATGAGG + Intergenic
941858666 2:170255238-170255260 CTGTGTTTCCTCACCCCAGTAGG - Intronic
948806212 2:240454344-240454366 CAGTGCACCCTCACCCCAGGAGG + Intronic
948858613 2:240742278-240742300 CCGGGCACCAGCACCCCAGAGGG - Intronic
1177450577 21:21259671-21259693 CTCTGCACCCTCAGCCCAGCAGG + Intronic
1178922988 21:36751549-36751571 CTGTGCACCCGCACCCCAGTCGG + Exonic
1179624650 21:42641984-42642006 CTGTGCACCTGCACCTAAGTCGG + Intergenic
1179780836 21:43699949-43699971 CTTTGACCCCGCAGCCCAGTGGG + Intergenic
1181772012 22:25132379-25132401 CTATGCCCCCTGACCCCAGTGGG - Intronic
1183074435 22:35417875-35417897 CTGGGCAACCTCACCCCCGTGGG - Intronic
953099450 3:39810254-39810276 CGGTGCGCCCGCAGCACAGTAGG - Intronic
961480967 3:127180544-127180566 CTGTGCAACCCCTCCCAAGTGGG + Intergenic
961525167 3:127492192-127492214 CCGTGCACACAGACCCCAGTGGG + Intergenic
968503970 4:963555-963577 CTGTTCACACGCAGCTCAGTGGG - Intronic
968561577 4:1285981-1286003 CTGTGCACTCAGCCCCCAGTGGG + Intergenic
971754220 4:30686362-30686384 CTGGGCAACCGGACCCCAGAAGG - Intergenic
976194374 4:82518683-82518705 CTGGGCAGCCAAACCCCAGTAGG - Intronic
976390110 4:84498017-84498039 CTGGGCACCCACAACCCAGGCGG - Exonic
977158088 4:93599136-93599158 CTGTGCACCAGCACTCTATTCGG - Intronic
982049750 4:151489134-151489156 CTCTGCACCCACATCCCACTGGG + Intronic
997188032 5:131901379-131901401 ATGTGCACACGGACCCCAGTGGG + Intronic
998407434 5:141882116-141882138 CTGTGCACCCAACCCCCACTAGG + Intergenic
1003146334 6:3513408-3513430 CTGTGTACCTGCAGCCCAGGTGG - Intergenic
1011744285 6:90394436-90394458 CTATGCACCCTCCCACCAGTGGG - Intergenic
1017294364 6:152776872-152776894 CTGCCCACCAGCACCCCAGTGGG - Intergenic
1019494083 7:1329535-1329557 CTGGGCACCTGCCCCCCAGAGGG + Intergenic
1019573647 7:1725561-1725583 GGGTGCACTCACACCCCAGTTGG + Intronic
1020105439 7:5420438-5420460 CTGGGAACCTGCACCCCGGTAGG - Intronic
1020743771 7:12055409-12055431 CTGTGCTGCTGCACCCCACTGGG + Intergenic
1020815814 7:12904175-12904197 CCCTGCACCCCCACCCCAGCAGG - Intergenic
1023943351 7:44784470-44784492 CTGTGCACCTGCACCCTAGCAGG + Intergenic
1029545003 7:101206058-101206080 CTGTGCCCACGAACCCCTGTGGG + Exonic
1034889819 7:154829895-154829917 CTGTGCACCAGCATCACAGGAGG - Intronic
1038220878 8:25606423-25606445 CTGTGTACCTGCACACAAGTTGG + Intergenic
1039289344 8:36077305-36077327 GTGTGCACCCCCACCCCCATGGG + Intergenic
1049759144 8:144324051-144324073 CTGCTCACAGGCACCCCAGTCGG - Intronic
1058010366 9:99970101-99970123 ATGGGCACCTGCACCCCAGAAGG + Exonic
1058042342 9:100316644-100316666 CTGTGCCACTGCACTCCAGTTGG - Intronic
1062343573 9:136104422-136104444 CTGTGCACCTGCACACCTGCTGG - Intergenic
1062379879 9:136281999-136282021 CTCTGCACTCGGACCCCAGGGGG + Intronic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1187182988 X:16960320-16960342 TTGTGCCACCGCACTCCAGTTGG + Intronic
1189372860 X:40443803-40443825 CTGTGCGCGCGCACACAAGTTGG + Intergenic
1190281039 X:48930258-48930280 TTGTTCACCCGTACCCCCGTGGG - Intronic
1192317631 X:70065478-70065500 CTGTGCCCCCGCTACCCAGCTGG - Intergenic
1195037445 X:100982690-100982712 CTGTACCACTGCACCCCAGTCGG - Intronic