ID: 1178923773

View in Genome Browser
Species Human (GRCh38)
Location 21:36758630-36758652
Sequence CCTAGGTAGGGGCCACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178923773_1178923783 25 Left 1178923773 21:36758630-36758652 CCTGCTTGTGGCCCCTACCTAGG No data
Right 1178923783 21:36758678-36758700 CACTTAAAGATAGGAAATGGGGG No data
1178923773_1178923780 22 Left 1178923773 21:36758630-36758652 CCTGCTTGTGGCCCCTACCTAGG No data
Right 1178923780 21:36758675-36758697 ACTCACTTAAAGATAGGAAATGG No data
1178923773_1178923779 16 Left 1178923773 21:36758630-36758652 CCTGCTTGTGGCCCCTACCTAGG No data
Right 1178923779 21:36758669-36758691 GCAATTACTCACTTAAAGATAGG No data
1178923773_1178923781 23 Left 1178923773 21:36758630-36758652 CCTGCTTGTGGCCCCTACCTAGG No data
Right 1178923781 21:36758676-36758698 CTCACTTAAAGATAGGAAATGGG No data
1178923773_1178923782 24 Left 1178923773 21:36758630-36758652 CCTGCTTGTGGCCCCTACCTAGG No data
Right 1178923782 21:36758677-36758699 TCACTTAAAGATAGGAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178923773 Original CRISPR CCTAGGTAGGGGCCACAAGC AGG (reversed) Intronic