ID: 1178924261

View in Genome Browser
Species Human (GRCh38)
Location 21:36761869-36761891
Sequence GCGGAGGAGCTTGACAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 85}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178924261_1178924268 3 Left 1178924261 21:36761869-36761891 CCAGAGCTGTCAAGCTCCTCCGC 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1178924268 21:36761895-36761917 GTGCGTGGCAGCTGGTGCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 185
1178924261_1178924271 19 Left 1178924261 21:36761869-36761891 CCAGAGCTGTCAAGCTCCTCCGC 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1178924271 21:36761911-36761933 GCCTGGGCGGGCCCTGCACTTGG 0: 1
1: 0
2: 82
3: 416
4: 713
1178924261_1178924270 7 Left 1178924261 21:36761869-36761891 CCAGAGCTGTCAAGCTCCTCCGC 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1178924270 21:36761899-36761921 GTGGCAGCTGGTGCCTGGGCGGG 0: 1
1: 0
2: 6
3: 71
4: 580
1178924261_1178924264 -5 Left 1178924261 21:36761869-36761891 CCAGAGCTGTCAAGCTCCTCCGC 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1178924264 21:36761887-36761909 TCCGCCACGTGCGTGGCAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 49
1178924261_1178924269 6 Left 1178924261 21:36761869-36761891 CCAGAGCTGTCAAGCTCCTCCGC 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1178924269 21:36761898-36761920 CGTGGCAGCTGGTGCCTGGGCGG 0: 1
1: 0
2: 5
3: 35
4: 344
1178924261_1178924267 2 Left 1178924261 21:36761869-36761891 CCAGAGCTGTCAAGCTCCTCCGC 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1178924267 21:36761894-36761916 CGTGCGTGGCAGCTGGTGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 158
1178924261_1178924273 20 Left 1178924261 21:36761869-36761891 CCAGAGCTGTCAAGCTCCTCCGC 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1178924273 21:36761912-36761934 CCTGGGCGGGCCCTGCACTTGGG 0: 1
1: 0
2: 0
3: 11
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178924261 Original CRISPR GCGGAGGAGCTTGACAGCTC TGG (reversed) Intronic
901848333 1:11998940-11998962 GAGCAGGAGCTTGACAGCCAAGG - Intronic
902085726 1:13860142-13860164 ACGGAGGTGTTTTACAGCTCTGG - Intergenic
913544389 1:119853243-119853265 GCGGGGGAGGTGGAGAGCTCGGG - Intergenic
915623987 1:157103430-157103452 TCTGAGGAGCTTGCCAGCTCTGG + Intergenic
924011005 1:239665297-239665319 GCTGAGGAGCCTAGCAGCTCAGG - Intronic
1068545076 10:58335423-58335445 CCGGAGGAGCTTGAAGGCTGGGG + Intronic
1076319607 10:129568294-129568316 GGGGAGCAGGTTTACAGCTCAGG + Intronic
1077635273 11:3837911-3837933 GAGGAGGAGCTTCTCAGCTAGGG - Intronic
1079393766 11:20044184-20044206 GCGGCGAGGCATGACAGCTCAGG + Exonic
1090351689 11:126112081-126112103 AGAGAGGAGCTTGACAGCTAAGG - Intergenic
1094724128 12:33095137-33095159 AGGGAGGAGCTTGGCTGCTCTGG + Intergenic
1095672558 12:44876985-44877007 CAGGAGGTGCTGGACAGCTCCGG + Exonic
1096073618 12:48789062-48789084 GCGGCTGCGCTGGACAGCTCGGG - Intergenic
1097029752 12:56081952-56081974 GGGGAGGAGCTAGGCAGCTTGGG - Intronic
1101826852 12:108227101-108227123 GCGGAGGAGTTTGAGAGCTGCGG + Exonic
1103223046 12:119262236-119262258 GGGGAGGGGCTTGAAAGCTGAGG + Intergenic
1104900704 12:132188277-132188299 GCGGGGGGGCCTGGCAGCTCTGG - Intergenic
1104963281 12:132498160-132498182 GCTGTGGGGCTTGACAGATCTGG - Intronic
1113796436 13:113061360-113061382 CCGGGGGAGCTACACAGCTCGGG - Intronic
1120023946 14:79560905-79560927 GGGGAGCAGCTTGACAACACAGG - Intronic
1122848001 14:104511207-104511229 GCCGCCGAGCTTGACAGCTCTGG + Intronic
1122974304 14:105164728-105164750 GGGGAGGAACTGGACAGGTCTGG + Intronic
1124905012 15:33860072-33860094 GCAGAGGAGCTGGACAGTGCAGG + Intronic
1127294434 15:57597153-57597175 GGTGAGGAGGTTGACAGTTCTGG + Intronic
1128523239 15:68389411-68389433 GGGGAGGAGCATGGCAGCCCTGG + Intronic
1129760166 15:78124649-78124671 GCGGAGGAGCTAAACAGCAGGGG - Intronic
1131918845 15:97301351-97301373 CTGGAGGAGCATGACTGCTCTGG + Intergenic
1132293829 15:100720575-100720597 GGGGAGGAGGAGGACAGCTCAGG + Intergenic
1138100000 16:54244677-54244699 CCAGAGGAGCGTGACAGCCCGGG - Intergenic
1142673642 17:1499756-1499778 GCGGGGGAGCAGGACAGCTGCGG + Intronic
1148755764 17:49972229-49972251 GCGGGGGATCTGGTCAGCTCTGG - Intronic
1152161310 17:78670162-78670184 GCGGAGGAGGAGGAAAGCTCCGG + Intergenic
1153388489 18:4527752-4527774 TGGGTGGAGCTTGAGAGCTCTGG - Intergenic
1153463662 18:5364941-5364963 GCCAAGGAGCTTGTCATCTCAGG + Intergenic
1157562603 18:48659441-48659463 GCTGCTGAGCTTCACAGCTCCGG + Intronic
1159374856 18:67580138-67580160 GGGGCTGAGCTTGCCAGCTCCGG - Intergenic
1161242457 19:3229891-3229913 GCAGAGGGGCTTGGGAGCTCAGG + Intronic
1166678515 19:44753903-44753925 GAGGAGCAGCTTGGCAGCTTGGG + Intronic
1168404141 19:56102170-56102192 CCGGCAGAGCTTGCCAGCTCAGG - Intronic
936556868 2:113503763-113503785 GCGGCGGAGTTGGGCAGCTCCGG + Intergenic
936951216 2:117979371-117979393 GGGGAGGAGCTTTAGAGCTGAGG - Intronic
937292450 2:120789935-120789957 GGAGAGGAGCTAGCCAGCTCGGG + Intronic
938662690 2:133503927-133503949 GAGGAGGAGAGTGACAGCTAGGG - Intronic
938960853 2:136340272-136340294 GTGGAGGACCTTGACTGATCAGG - Intergenic
940285266 2:152027460-152027482 GGGGAGGAGCTTGAAAACTCAGG - Intronic
940467148 2:154045562-154045584 GCTGAGGAGGCTGACAGCTCTGG + Intronic
941637869 2:167955453-167955475 GCGGTGGGGCATGACAGATCAGG + Exonic
941670162 2:168284232-168284254 GAGAAGGAGCTTGCCAGCTGTGG - Intergenic
943470853 2:188292257-188292279 GCGGTGGGGGTGGACAGCTCCGG + Intronic
1170796453 20:19551672-19551694 GCCGAGGAGCATGGCAGCCCAGG - Intronic
1171489017 20:25503613-25503635 GCTGAGGAACATGGCAGCTCAGG - Intronic
1178813532 21:35906180-35906202 GAGGAGGAGCTGGACAGCTTTGG - Intronic
1178924261 21:36761869-36761891 GCGGAGGAGCTTGACAGCTCTGG - Intronic
1185411275 22:50684205-50684227 GAGGATGAGCTTGGCAGCTTGGG + Intergenic
969245296 4:5927967-5927989 GCGGTGGAGCTTGTCAACTCAGG - Intronic
977347617 4:95837835-95837857 GAGGAGAAGCTCAACAGCTCAGG + Intergenic
990112638 5:52346844-52346866 AAGGAAGAGCCTGACAGCTCTGG - Intergenic
995292188 5:110469697-110469719 GCTGAGGGGATTGACAGCTCTGG - Intronic
996411633 5:123164991-123165013 AGGGAGGAGTTTAACAGCTCTGG - Intronic
1001685510 5:173591978-173592000 ACCAAGGAGCTTAACAGCTCTGG + Intergenic
1003314422 6:4999088-4999110 GCAGAGGACCTTGAGAGGTCAGG + Intronic
1017000354 6:149992257-149992279 GCAGAGGAACCTAACAGCTCTGG - Intergenic
1018062710 6:160103155-160103177 GGGCAGGAGCTGGCCAGCTCAGG + Intronic
1030597949 7:111562123-111562145 GGGGAGGAGCGGGCCAGCTCCGG + Exonic
1031873665 7:127113947-127113969 TGGGAGGAGCATGAAAGCTCAGG - Intronic
1034336091 7:150324463-150324485 GCGGAGGTGCTTCCCAGCCCAGG + Intronic
1037513932 8:19610926-19610948 GGGGTGGACGTTGACAGCTCCGG - Intronic
1040478909 8:47805931-47805953 GTGTGGGAGATTGACAGCTCTGG - Intronic
1045655120 8:104378649-104378671 ACGGAGGAGCATGTCAGATCTGG + Intronic
1048470231 8:134698416-134698438 GCGGGGGAACCTGACAGCGCCGG + Intronic
1049820475 8:144630193-144630215 GAGGAGGAGCTGGACAGTGCCGG - Intergenic
1049896137 9:113548-113570 GCGGCGGAGTTGGGCAGCTCCGG - Intergenic
1053739273 9:41123726-41123748 GCGGCGGAGGTGGGCAGCTCCGG - Intergenic
1054689077 9:68307596-68307618 GCGGCGGAGGTGGGCAGCTCCGG + Intergenic
1056226619 9:84501763-84501785 GTGGAGGAGCTAGACAGAGCAGG + Intergenic
1056770041 9:89471632-89471654 GCTGAGGTGCATGCCAGCTCAGG + Intronic
1056770053 9:89471728-89471750 GCTGAGGTGCATGCCAGCTCAGG + Intronic
1056770066 9:89471824-89471846 GCTGAGGTGCATGCCAGCTCAGG + Intronic
1056770079 9:89471920-89471942 GCTGAGGTGCATGCCAGCTCAGG + Intronic
1056770091 9:89472016-89472038 GCTGAGGTGCATGCCAGCTCGGG + Intronic
1056785929 9:89592504-89592526 GCAGAGAAGCTTCACTGCTCAGG + Intergenic
1060005073 9:119992572-119992594 GCGGAGGAGCCTGGCAGGACAGG + Intergenic
1060280965 9:122215452-122215474 GCTGAGGAACTTGAAAGCTGGGG - Intronic
1060772810 9:126345121-126345143 TCAGAGGATCTTGACAGCTGTGG + Intronic
1061394267 9:130334911-130334933 GCCCAGGAGATTGAGAGCTCTGG - Intronic
1061401561 9:130371086-130371108 GGGGAGGAGCCTGTCAGCCCCGG + Intronic
1061449726 9:130661497-130661519 GCGACGGAGCCTGAGAGCTCCGG + Intergenic
1187388870 X:18872925-18872947 AGGGAGGAGGTTGAAAGCTCAGG - Intergenic
1187519867 X:20003785-20003807 GCGGGGGTGCCTGGCAGCTCAGG + Intergenic
1189132135 X:38510774-38510796 TCTGAGGAGCTTGAGAGCTGGGG - Intronic
1191155239 X:57266460-57266482 CCAGAGAGGCTTGACAGCTCTGG - Intergenic
1197114482 X:122817270-122817292 GTAAAGGACCTTGACAGCTCTGG + Intergenic
1198012584 X:132573701-132573723 GGGCAGGAGTTTGACAGGTCTGG + Intergenic
1198229582 X:134676327-134676349 GCGGCGGAGCTTATCTGCTCCGG - Intronic
1200297282 X:154933321-154933343 GAGGAGGAGATTGACAGCTGAGG - Intronic