ID: 1178930697

View in Genome Browser
Species Human (GRCh38)
Location 21:36816137-36816159
Sequence AACTGAGGCTAAGAGTAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 654
Summary {0: 1, 1: 0, 2: 9, 3: 96, 4: 548}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178930697_1178930699 -5 Left 1178930697 21:36816137-36816159 CCATACTACTCTTAGCCTCAGTT 0: 1
1: 0
2: 9
3: 96
4: 548
Right 1178930699 21:36816155-36816177 CAGTTTTTACATCCATAAAAAGG 0: 1
1: 6
2: 136
3: 977
4: 4342
1178930697_1178930703 21 Left 1178930697 21:36816137-36816159 CCATACTACTCTTAGCCTCAGTT 0: 1
1: 0
2: 9
3: 96
4: 548
Right 1178930703 21:36816181-36816203 CAATAAAAGAATGTCTGACTGGG 0: 1
1: 0
2: 1
3: 26
4: 280
1178930697_1178930702 20 Left 1178930697 21:36816137-36816159 CCATACTACTCTTAGCCTCAGTT 0: 1
1: 0
2: 9
3: 96
4: 548
Right 1178930702 21:36816180-36816202 TCAATAAAAGAATGTCTGACTGG 0: 1
1: 0
2: 2
3: 21
4: 284
1178930697_1178930700 -4 Left 1178930697 21:36816137-36816159 CCATACTACTCTTAGCCTCAGTT 0: 1
1: 0
2: 9
3: 96
4: 548
Right 1178930700 21:36816156-36816178 AGTTTTTACATCCATAAAAAGGG 0: 1
1: 0
2: 17
3: 238
4: 1788
1178930697_1178930704 22 Left 1178930697 21:36816137-36816159 CCATACTACTCTTAGCCTCAGTT 0: 1
1: 0
2: 9
3: 96
4: 548
Right 1178930704 21:36816182-36816204 AATAAAAGAATGTCTGACTGGGG 0: 1
1: 0
2: 2
3: 42
4: 420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178930697 Original CRISPR AACTGAGGCTAAGAGTAGTA TGG (reversed) Intronic
900711015 1:4114010-4114032 AACTGAGGTTCAGAGAAGTTTGG + Intergenic
901492419 1:9603246-9603268 AACTGAGGCTGAGAACAGCAGGG - Intronic
902548004 1:17202262-17202284 AACTGAGGCACAGAGAAGTTGGG - Intergenic
902566313 1:17314014-17314036 AACTGAGGCTCAGAGAGGTAAGG - Intronic
902622749 1:17659970-17659992 AACTGAGGCCAAGAGCAATGTGG + Intronic
902782636 1:18714603-18714625 AACTGAGGCCCACAGCAGTAAGG - Intronic
902798291 1:18813980-18814002 AACTGAGGCCCAGAGAAGGATGG - Intergenic
902871843 1:19318415-19318437 AACTGAGGCTCAGAGCAGTGAGG - Intronic
902933144 1:19745387-19745409 AACTGAGGCTCAGAGAGGTGAGG - Intronic
902940756 1:19799168-19799190 AACTGAGGCTCAGAGAGGTGAGG - Intronic
903235429 1:21947558-21947580 AACTGAGGCACAGAGTGGTCGGG - Intergenic
903268920 1:22175660-22175682 AACCAAGGCTCAGAGAAGTAAGG - Intergenic
903333892 1:22612411-22612433 AACTGAGGCTCAGAGAAGAAAGG + Intergenic
903376801 1:22871494-22871516 AACTGAGGCTCAGAGAAATGAGG - Intronic
903496023 1:23767813-23767835 AACTGAGGCTCAGAGAGGTGTGG - Intergenic
903607088 1:24582861-24582883 AGCTGAGGCTCAGAGAAGTTAGG - Intronic
903733648 1:25516428-25516450 AACTGAGGCTCAGAGAGGCAGGG + Intergenic
903769620 1:25755640-25755662 AACTGAGGCTCAGAGAGGTGAGG + Intronic
904337522 1:29807800-29807822 AACTGAGGCTCAGAGAAGCTGGG - Intergenic
905123369 1:35699732-35699754 AACTGAGGCAGAGAGAAGTCAGG - Intergenic
905241596 1:36584946-36584968 AACTGAGGCTTAGAGAGGTGAGG + Intergenic
905507064 1:38488535-38488557 AACAGAGGCTCAGAGTGGTTAGG - Intergenic
905612808 1:39369599-39369621 AACTGAGGCTCACAGAAGTTAGG - Intronic
905850012 1:41266783-41266805 AACTGAGGCTCAGAGTGGCCTGG + Intergenic
905879603 1:41454953-41454975 AACTGAGGATTAGAGCAGTCTGG - Intergenic
905936856 1:41831315-41831337 AACTGAGGCTCAGAGAAGTCAGG - Intronic
906011918 1:42535369-42535391 AACTAAGGCTAAGAAAAGTGAGG + Intronic
906028675 1:42699010-42699032 AAATGAGACTAATAGTAGTAAGG + Intronic
906700986 1:47857771-47857793 AAATGATGCTAAGAGAAGCAAGG - Intronic
906727956 1:48057814-48057836 AACTGAGGCCCAGAGAAGTTAGG + Intergenic
906791834 1:48665532-48665554 AACTGAGGCTCACAGAAGGAAGG + Intronic
906796105 1:48697474-48697496 AAGTGAGGCTGAGAGAAGTGTGG + Intronic
906812816 1:48846602-48846624 AACTGAGCCCAAGAGGAGAAAGG - Intronic
906847405 1:49208163-49208185 AACTGAGGCTAGGAGAGGTTTGG + Intronic
906876531 1:49544710-49544732 AACTGAGGTTCAGATTAGTCTGG + Intronic
907517215 1:55000404-55000426 AACTGAGGCTCAGAGAGGAAAGG - Intronic
907518363 1:55007501-55007523 AACTGAGGCTAGGGAAAGTAAGG - Intronic
907663086 1:56411557-56411579 AACTGAGGCTCAGGGAAGCAGGG + Intergenic
907708504 1:56853603-56853625 AACTGAGGCCAAGAGGACCAAGG + Intergenic
907750720 1:57260670-57260692 AACTGAGGCACAGAGAAGTCAGG + Intronic
907758542 1:57334917-57334939 AACTGAGGCCCAGAGAAGTGAGG + Intronic
907927513 1:58968302-58968324 AAATGAGGCTCAGAGAAGTGGGG + Intergenic
907930548 1:58995262-58995284 AACTGAGGCTCAGAGAGGTGAGG + Intergenic
908250017 1:62258141-62258163 AACTGAGGCTCAGAGATGTCAGG - Intronic
908789961 1:67771351-67771373 AACTGTGGCTCAGAGAAGTTAGG + Intronic
909123742 1:71638656-71638678 AACTAAGGCAAAGAGAAGTAAGG + Intronic
910015352 1:82517115-82517137 AACTGAGGATCAGAGAAGTCAGG - Intergenic
910918561 1:92318341-92318363 AACTGAGGCTCAGAGTGGTATGG + Intronic
911377369 1:97067640-97067662 AAATGAGGCACAGAGAAGTAAGG + Intergenic
911706791 1:101023700-101023722 AACTGAGGTTCAGAGAAGTTTGG + Intronic
912231049 1:107793212-107793234 CACTGAGGCAGTGAGTAGTAGGG + Intronic
912511261 1:110191805-110191827 AACTGAGGCTCAGAGGAGTAGGG + Intronic
912529697 1:110311406-110311428 AACTGAGGCTCAGAGAACTGTGG - Intergenic
913095273 1:115510626-115510648 AAGTGAGTTTAAGAGAAGTAGGG + Intergenic
913194708 1:116445931-116445953 AACTGAGGCTATGAGTAGTTTGG - Intergenic
915270918 1:154752789-154752811 AACTGAGGCCAAGAGCAGTGGGG - Intronic
916188478 1:162156303-162156325 AACTGAGGCTCAGAGGGGTAGGG + Intronic
916581603 1:166114276-166114298 AACTGAGGCTCAGGGAAGGAGGG + Intronic
916712195 1:167421556-167421578 AGCTAAGGCCAAGAGTAGAAGGG - Exonic
917069385 1:171133472-171133494 CACAGAAGCAAAGAGTAGTAGGG + Intergenic
917510930 1:175668781-175668803 AACTGAGGCTAAAAGAAGCCAGG + Intronic
917801198 1:178572253-178572275 AACTGAGGTTTAGAGAAGTTCGG + Intergenic
919157851 1:193789550-193789572 AACTGAGGCTTAGACTAGGGTGG - Intergenic
919731282 1:200915108-200915130 AATTGAGGCTAGGAGAGGTAGGG + Intronic
919800660 1:201352803-201352825 AACTGAGGCTCAGAGAAGTTAGG - Intergenic
919834382 1:201563616-201563638 AACTGAGGCTCAGAGAAGTGGGG - Intergenic
919897875 1:202020582-202020604 AACTGAGGCTCAGAAAAGGAAGG - Intergenic
920044038 1:203122100-203122122 AACTGAGGCTCAGGGAGGTATGG + Intronic
921338345 1:214110233-214110255 AACTGAGGCAAGGAGTAAAACGG + Intergenic
921839485 1:219813150-219813172 AACTAAGGCACAGAGTGGTAGGG + Intronic
922137259 1:222841414-222841436 AACTGAGGCACAGAGAAGTTAGG + Intergenic
922220772 1:223556928-223556950 AACTGAGGCGAGGGGTAGGAGGG + Intronic
922235828 1:223721788-223721810 AACTGAGGCTCAGAGGGGTTGGG - Intronic
923006913 1:230057617-230057639 AACTGAGGCTCAGAAAAGTCAGG - Intergenic
923110205 1:230884134-230884156 AAGGGAGGCTGAGAGTAGGAGGG + Intergenic
924578164 1:245299635-245299657 AACGGAGGCTCAGAGAAGTTAGG + Intronic
924654584 1:245962015-245962037 AACTGAGGCTCAGAGCAGCCTGG + Intronic
1063498524 10:6531889-6531911 AACTGAGGCTCAGAAAATTAAGG + Intronic
1063764289 10:9120140-9120162 AACTGAGGAGGAGAGTTGTAGGG + Intergenic
1065111962 10:22449109-22449131 AACTGAGGCTTAGAGAAGATGGG + Intronic
1065730436 10:28705225-28705247 AACTGAGGCTGAGAGAGGTTTGG - Intergenic
1065858031 10:29846354-29846376 AACTGAGGCTCAGAGGAATTAGG - Intergenic
1065888088 10:30096305-30096327 AACTGAGGCTCAGGGCAGTGGGG - Intronic
1066330457 10:34416032-34416054 AACTGCTGCTCAGAGTAGTTAGG + Intronic
1067020425 10:42792013-42792035 AACTGAGGCTGAACGTAGGATGG - Intronic
1067473903 10:46554035-46554057 AACTGAGGCTCAAAGAAGTTAGG - Intronic
1067500135 10:46796190-46796212 AACTGAGGCTGAACGTAGGATGG - Intergenic
1068198612 10:53751644-53751666 AACTGAGGCTAACCTTTGTAAGG + Intergenic
1068755813 10:60651672-60651694 AACTGAGGCAGAGAGGAGTTAGG - Intronic
1069789325 10:71009604-71009626 AACTGAGGCTAAGAGAGGGTAGG + Intergenic
1069910440 10:71755527-71755549 AACTGAGGCTCAGAGAGGGAAGG + Intronic
1070098068 10:73358007-73358029 AACTGAGGCTTAGAGAAGTTAGG - Intronic
1070704646 10:78628929-78628951 AACTGAGGCTGAGAGAAGCGAGG + Intergenic
1071454426 10:85833639-85833661 AACTGATGCTAAGACCAGGATGG + Intronic
1073417590 10:103396935-103396957 AACTGAGGCTCTGAAAAGTAAGG - Intronic
1074000013 10:109362412-109362434 AACTGAGGCAAAGAGAAATTTGG + Intergenic
1074087721 10:110221285-110221307 AGCTGAGGCTCAGAGAGGTATGG - Intronic
1074126913 10:110535936-110535958 AACAGAGGCTCAGAGAAGTAAGG + Intergenic
1074525751 10:114261663-114261685 AAATGAGGCTCAGAGAAGTGTGG - Intronic
1074712004 10:116185241-116185263 AACTGAGGCTATGAGAGGTTAGG - Intronic
1074901290 10:117818342-117818364 AACCGAGGCTAATAGAAATAAGG - Intergenic
1075162596 10:120037730-120037752 AACTGAGGCTCAGAGAGGTTAGG + Intergenic
1075670134 10:124258749-124258771 ATCTGAAGCTCAGAGTAGGAGGG - Intergenic
1075684102 10:124352054-124352076 AACTGAGGCTCAGAGAGGTTGGG - Intergenic
1075948800 10:126459995-126460017 AACTGAGGCTCATGGTAGTTTGG + Intronic
1076126180 10:127975899-127975921 AACTGAGGCTCAGAGATATAGGG - Intronic
1077387886 11:2281432-2281454 AACAGAGGCTCAGCATAGTATGG - Intergenic
1077777517 11:5287939-5287961 AACTGAGGCTCAGAGAAGGGTGG + Intronic
1078667469 11:13338739-13338761 CACTGAGGCTCAGAGAGGTATGG - Intronic
1079082682 11:17424851-17424873 AACTCAGGCTCAGAGAAGTTGGG - Intronic
1079352178 11:19701050-19701072 AACTGAGGATCAGAGAAGTGAGG + Intronic
1079354272 11:19716927-19716949 AACTGAGGCAAAGACCAGTTTGG + Intronic
1079367188 11:19819572-19819594 GACTGAGGGTTAGAGTAGCATGG + Intronic
1080443379 11:32315276-32315298 AACTGAGGCCAAGAGAGGTTAGG - Intergenic
1080775787 11:35385385-35385407 AACTGAGGCTCAGAGAAGTTAGG + Intronic
1082097025 11:48139291-48139313 AGCTGAGGCTCAGAGCAGTTGGG + Intronic
1082881220 11:58040343-58040365 AACTGAGGCTCAGAGAGGTGAGG + Intronic
1083156824 11:60828502-60828524 AACTGAGGCCCAGAGAACTAAGG + Intergenic
1083266149 11:61547778-61547800 AACTGAGGCCAGGAGAGGTAGGG - Intronic
1083553595 11:63608871-63608893 AACTGAGGTTAGGAGTAATTAGG - Intronic
1083854511 11:65386185-65386207 AACTGAGGCCCAGAGGAGAAGGG + Intergenic
1083996241 11:66274393-66274415 AACTGAGGCTCAGAGTGGTCAGG + Intronic
1084532001 11:69732843-69732865 AACTGAGGCTCAGAGAGGTGAGG + Intergenic
1084906908 11:72355571-72355593 AACTGAGGCTTAGAGAATTAAGG + Intronic
1084947178 11:72644384-72644406 AACTGAGGCCAAAAATAGGAAGG - Intronic
1085267682 11:75246868-75246890 AACTGAGGCCAAGAGTATGCAGG + Intergenic
1085450073 11:76626542-76626564 AACTGAGGCTGAGAGAGGTGAGG + Intergenic
1085712698 11:78844297-78844319 AAGTGAGGCTCACAGTAGTGGGG + Intronic
1085967125 11:81540651-81540673 AACTCAGGCCAAGAGCTGTAAGG + Intergenic
1086080832 11:82901015-82901037 AACTGAGGCTCAGAGAGGTGCGG + Intronic
1087023793 11:93629701-93629723 TACTGGGGCTCAGAGAAGTAAGG - Intergenic
1087900063 11:103630553-103630575 AACTGAGTCAAAGAGCAGTTAGG + Intergenic
1088584873 11:111353487-111353509 GCCTGGGGCTCAGAGTAGTAAGG - Exonic
1088596539 11:111445198-111445220 AACTGAGGCTCAGAGAGGTTTGG - Intronic
1089314237 11:117580147-117580169 AACTGAGGCAGAGAGTAGGGAGG + Intronic
1090027440 11:123179843-123179865 AACAGAGGCTCAGAGAAGTTAGG - Intronic
1090032670 11:123220629-123220651 AACTGAGGCTTAGAGAGGCAAGG + Intergenic
1091930691 12:4392935-4392957 AACTGAGGCTCAGAGAAGCAAGG - Intergenic
1095533465 12:43218657-43218679 AACTGAGGCTCAGAGAAGTTAGG - Intergenic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1096614410 12:52823717-52823739 AACTGAGGCACAGAGCAGGAAGG - Intronic
1097269962 12:57767857-57767879 TTCTGAGGCTAAAAGTAGAAAGG - Intronic
1097752749 12:63375775-63375797 AACTGAGGCAAAGAGCAGTTAGG - Intergenic
1098253931 12:68597366-68597388 AAATGAGTCTAAAACTAGTATGG - Intergenic
1099341143 12:81436196-81436218 ACCTGAGGCTAAGAGGTGGAGGG + Intronic
1099890584 12:88584666-88584688 AACTGAGGATCAAAGAAGTATGG + Intergenic
1100040614 12:90313005-90313027 AACAGAGGCTAAGAAAATTAAGG - Intergenic
1100519070 12:95356381-95356403 AACTGAGGCTCAGAGAGGTTAGG - Intergenic
1100889578 12:99109667-99109689 AGCTGAGGCACAGAGAAGTAAGG + Intronic
1100950310 12:99841086-99841108 AACTGAGGCACGGAGTAGTTAGG - Intronic
1101990271 12:109478118-109478140 AACTGAGGCTCAGAGAGGTGAGG - Intronic
1102016796 12:109653438-109653460 AACTAAGGCTCAGAGAGGTAAGG - Intergenic
1102055376 12:109892767-109892789 CACTGAGGCTTAGAGTAGTTGGG - Intergenic
1102182004 12:110919907-110919929 AACTGAGGCTCAGAGAGGTTGGG + Intronic
1102219782 12:111186668-111186690 AACAGAGGCTCAGAGTGGCAAGG - Intronic
1102510783 12:113413975-113413997 AACTGAGGCTAAGGGAACTTAGG - Intronic
1102595704 12:113991013-113991035 AACTGAGGCTCAGAGAGTTAAGG - Intergenic
1102799743 12:115721626-115721648 AACTGAGGCTCAGAGAGGTAAGG - Intergenic
1102817648 12:115880620-115880642 GACTGAGGCTCAGAGAAGTGAGG - Intergenic
1102953868 12:117047024-117047046 AACTGAGGCTCAGAGAAGTTAGG - Intronic
1103271649 12:119678364-119678386 AACTGAGGCACAGAGCAGTAGGG + Intronic
1103361523 12:120357279-120357301 AACTGAGGCTCAGAGAAGGGAGG + Intronic
1103366610 12:120388905-120388927 AACTGAGGCTCAGAGAGGTTAGG - Intergenic
1103461761 12:121110581-121110603 AACTGAGGCAGAGAGTGGAAGGG + Intergenic
1103763846 12:123268638-123268660 AACTGAGGCTCGGAGTGGCACGG - Intronic
1104518831 12:129453947-129453969 AACTGAGAGTAAGAGAAGGATGG + Intronic
1104756302 12:131271454-131271476 AACTGAGGCACAGAGAAGTTAGG - Intergenic
1105534558 13:21253051-21253073 AATTGAAGCAAAGAGTAGAAAGG + Intergenic
1106529645 13:30577711-30577733 AAATGAGGCTAATAATAGCAGGG + Intronic
1106649339 13:31672849-31672871 AACTGAGTCTAAGAGACCTATGG - Intergenic
1106896772 13:34311616-34311638 AACTGAGGCATAGAGTAATGTGG - Intergenic
1107097165 13:36549329-36549351 AACTGAGGCCCAGAGCAGTTGGG - Intergenic
1108261535 13:48661601-48661623 AACTGAGGCTCAGAGAAGATAGG + Intronic
1108283310 13:48880966-48880988 AACTGAGGCAAATGGTAGGAAGG + Intergenic
1108528929 13:51310750-51310772 AATTGAAGCTAAAAGTATTAGGG + Intergenic
1108533131 13:51346028-51346050 AACTGAGGCTCAGAGAAGTTGGG - Intronic
1108538002 13:51406191-51406213 AATTGAAGCTGTGAGTAGTAGGG - Intronic
1110764958 13:79272474-79272496 ATCTGAGGCTCAGAGAAGTCAGG - Intergenic
1110846253 13:80193529-80193551 AACTGAGGCTTATAGGAGTAAGG - Intergenic
1111880599 13:93951637-93951659 AACTGAGGCTGAGAGGGGTTGGG - Intronic
1112627384 13:101121099-101121121 AACTGAGGGTCAGATTAGTGAGG + Intronic
1113356812 13:109588886-109588908 AACTGAGGCACAGAGAAGTTAGG + Intergenic
1115354207 14:32430301-32430323 AACTGAGGCCAAGAAATGTATGG + Intronic
1115623046 14:35159755-35159777 AACTGAGGCTCAGAAAAGTTCGG + Intronic
1115652929 14:35416218-35416240 AACTGAGGCTAAAAATAGGTGGG + Intergenic
1115798116 14:36961580-36961602 GACTGAGGCTAAGGACAGTAAGG - Intronic
1115961307 14:38837912-38837934 AACAGAGGCCCAGACTAGTAGGG - Intergenic
1116507307 14:45700017-45700039 AACTAAAACTAAGAGTAGAAGGG - Intergenic
1117189959 14:53279737-53279759 AACTGAGGCCAGGAGCAGTGTGG + Intergenic
1117246346 14:53890367-53890389 AACTGAGGCTAACAGAAGCTAGG + Intergenic
1118785209 14:69040000-69040022 AACTGAGGCTCAGAGAAGTTAGG + Intergenic
1118795866 14:69143381-69143403 AACTGAGGCTTACAGAAGTTAGG - Intronic
1118802540 14:69203953-69203975 AACTGAGGCTTAGAGAAGTTTGG + Intronic
1118979939 14:70708135-70708157 AACTGAGGCTTAGAAAAGTTGGG - Intergenic
1119037856 14:71245787-71245809 AACTGAGGTCAAGAGAAGTGAGG + Intergenic
1119265896 14:73263147-73263169 AACTGAGGCTTGGAGAAGTTGGG - Intronic
1119647073 14:76355671-76355693 AACTGAGGCTCAGAGAAGTTAGG - Intronic
1119661884 14:76458042-76458064 AACTGAGGCTCAGAGAAGTTAGG + Intronic
1119924854 14:78483816-78483838 AACTGAGGCCTAGAGAAGTATGG + Intronic
1121421164 14:93816126-93816148 AACTGAGCCTAAGAGAAACAAGG + Intergenic
1121483443 14:94295506-94295528 AACTGAGGCTAAGAGAGGTTAGG - Intergenic
1121537418 14:94700287-94700309 AACTGAGGCTCAGAGAGGTTAGG + Intergenic
1121677706 14:95767678-95767700 AACCGAGGCTCAGAGATGTAAGG + Intergenic
1121861852 14:97326046-97326068 AACTGAGGCTTAGGGAAGTTAGG - Intergenic
1122047732 14:99035622-99035644 AACTGAGGTTCAGAGAAGTTTGG - Intergenic
1122089265 14:99327484-99327506 AACTGAGGCTCAGAGAGGAAGGG + Intergenic
1122664523 14:103319308-103319330 AACAGAGGCCAAGAGTATTGGGG - Intergenic
1123420369 15:20125803-20125825 AACTGAGGCCCAGAGAAGTAAGG - Intergenic
1123445490 15:20327721-20327743 AACTGAGGCCCAGAGAAGTAAGG + Intergenic
1123529593 15:21132339-21132361 AACTGAGGCCCAGAGAAGTAAGG - Intergenic
1124073329 15:26415893-26415915 AACTAAGGCAAAGACTAATATGG + Intergenic
1125483633 15:40097613-40097635 AACTGAGGCTCAGAGAAGTGAGG - Intronic
1126673430 15:51136892-51136914 CACTGAGGCTTAGAGGAGTAGGG + Intergenic
1128090551 15:64916063-64916085 ATCTGAGGCTTAGAGTGGTTGGG + Intronic
1128225089 15:65995960-65995982 AACTGAGGCACAGAGAGGTAAGG + Intronic
1128254965 15:66189669-66189691 AACTGAGGCTCAGAGAGGTGAGG - Intronic
1128440456 15:67703049-67703071 AATGGAGGCTCAGAGTAGTGAGG - Intronic
1128452625 15:67814791-67814813 AACTGAGGCTCAGAGAGGTTAGG - Intergenic
1128749170 15:70136425-70136447 AACTGAGGCTCAGAGAGGTTTGG + Intergenic
1128749855 15:70141036-70141058 AACTGAGGCTCAGAGAGGTTTGG + Intergenic
1129226746 15:74174662-74174684 AACTGAGGCCAAGAGAAGGGCGG - Intronic
1129372395 15:75105735-75105757 AACTGAGGCTCAGAGAAGGACGG - Intronic
1129380056 15:75158946-75158968 AACTGAGGCTGAGAGAAGGAAGG - Intergenic
1129678451 15:77644761-77644783 AACTGGGGCTAAGAGGGGTGAGG + Intronic
1129797627 15:78390029-78390051 AACTGAGGCCTAGAGAAGAAAGG - Intergenic
1130321640 15:82847383-82847405 CCCTGGAGCTAAGAGTAGTAAGG - Intronic
1130576697 15:85099242-85099264 AACTGAGGCTTAGAGAGGTCAGG + Intronic
1130695749 15:86129622-86129644 AACTGGGGCTGAGAGTGGTGGGG + Intergenic
1130745170 15:86645498-86645520 AACTGAGGCTCAGTGGAGTTTGG + Intronic
1131216015 15:90535872-90535894 AACTGAGGCTTAGAGAGGCATGG + Intronic
1131557572 15:93413113-93413135 ACCTGAGACAAAGAGTGGTAAGG + Intergenic
1131879489 15:96847388-96847410 GACTAAGGCAAAGAATAGTAGGG - Intergenic
1132229231 15:100169513-100169535 AACTGAGGCCAGGAGAAGTTGGG + Intronic
1133625430 16:7566545-7566567 AACTGAGGCTCAGAGAGGTTAGG - Intronic
1133849547 16:9489259-9489281 AACTGAGACTAATAGAAGTTAGG + Intergenic
1133860833 16:9593645-9593667 AACTGAGGCTCAGAGAGGCAAGG - Intergenic
1134108640 16:11501042-11501064 AACTGAGGCTCAGAGAGGTACGG + Intronic
1134293321 16:12921979-12922001 AACTGAGGCTCAGAGTGGTTAGG + Intronic
1134315123 16:13111933-13111955 AACTGAGGCTCAGAGAGGTTAGG + Intronic
1134446598 16:14335966-14335988 AACTGAGGCTCAGAAGGGTAAGG + Intergenic
1134589963 16:15444455-15444477 AACTGAGGCTTAGGGAAGTTAGG - Intronic
1134871722 16:17657960-17657982 AACTGAGGCTCAGAGTTGTTAGG - Intergenic
1135397309 16:22141084-22141106 AACTGAGGCTCAGGGGGGTAAGG + Intronic
1136022310 16:27447988-27448010 AACTGAGGCCCAGAGTAGGAGGG + Intronic
1136087771 16:27897791-27897813 AACTGAGGCTCAGAGAGGTTAGG - Intronic
1136248385 16:28988308-28988330 AACTGAGGCACAGAGAGGTAAGG + Intronic
1136721257 16:32320877-32320899 AACTGAGGCCCAGAGAAGTAAGG - Intergenic
1136839640 16:33527163-33527185 AACTGAGGCCCAGAGAAGTAAGG - Intergenic
1137254842 16:46766315-46766337 AACTGAGGCCCAGAGCAGTTGGG - Intronic
1137568140 16:49546937-49546959 AACTGAGGCTCAGAGGAGTTAGG - Intronic
1138264180 16:55647687-55647709 AACTGAGACACAGAGAAGTAGGG + Intergenic
1138414815 16:56865575-56865597 AACTGAGGCTCAGAGAGGTTAGG - Intronic
1138491444 16:57379458-57379480 AACTGAGGCATAGAGAAGTTTGG + Intronic
1140229088 16:73102742-73102764 AACTGAGGCTTAGAGAGGTAAGG - Intergenic
1141043125 16:80689456-80689478 AACTGAGGCTCAGAGAAGGTAGG + Intronic
1141127126 16:81408735-81408757 AACTGAGGCTCAGAGAGGTCAGG + Intergenic
1141205787 16:81932281-81932303 AACTGAGGCCCAGAGAAGTGTGG - Intronic
1141483344 16:84321874-84321896 AACTGAGGCTAAGAGAGGTTGGG - Intronic
1141822888 16:86459773-86459795 AACTGAGGCTCAGAGAGGTTAGG - Intergenic
1141901541 16:86994295-86994317 AACTAAGGCTCAGAGAAGTGTGG + Intergenic
1203005175 16_KI270728v1_random:196893-196915 AACTGAGGCCCAGAGAAGTAAGG + Intergenic
1203136725 16_KI270728v1_random:1733014-1733036 AACTGAGGCCCAGAGAAGTAAGG + Intergenic
1203149806 16_KI270728v1_random:1827448-1827470 AACTGAGGCCCAGAGAAGTAAGG - Intergenic
1142748222 17:1971502-1971524 AACTGAGGCTCTGAGCAGGAAGG + Intronic
1142863948 17:2779227-2779249 AACCGAGGCTCAGAGAAGTCAGG - Intronic
1142958886 17:3539920-3539942 AACTGAGGCTCAGAGAGGTGAGG + Intronic
1143352050 17:6295951-6295973 AACTGAGGCTCAGAGAAGGGAGG - Intergenic
1144477115 17:15597894-15597916 AACTGAGGCATAGAGAAGTTGGG + Intronic
1144796887 17:17897774-17897796 AACTGAGGCTCAGAGAGGTCTGG - Intronic
1144921124 17:18765473-18765495 AACTGAGGCATAGAGAAGTTGGG - Intronic
1144951816 17:18998483-18998505 AACTGAGGCTCAGAGTCGGCTGG - Intronic
1144966509 17:19079952-19079974 AACTGAGGCTCAGAGGGGTTTGG - Intergenic
1144981409 17:19172105-19172127 AACTGAGGCTCAGAGGGGTTTGG + Intergenic
1144986815 17:19206134-19206156 AACTGAGGCTCAGAGGGGTTTGG - Intergenic
1145044778 17:19604971-19604993 AACTGGGGGGAGGAGTAGTATGG - Intergenic
1145328394 17:21850590-21850612 AACTGAGGCCTAGAGAGGTAAGG - Intergenic
1145897083 17:28465426-28465448 AACTGAGGCTCGGAGAAGTTGGG - Intronic
1145909103 17:28532489-28532511 AACTGAGGTTCAGAGAAGAAAGG - Intronic
1146259615 17:31412889-31412911 AACTGAGGCTCAGAGAGGTCGGG + Intronic
1146460345 17:33041182-33041204 AACTGAGGCCCAGAGTAGTTAGG - Intronic
1146937712 17:36822796-36822818 AACTGAGGCTGAGAGCATTTAGG + Intergenic
1147385610 17:40079771-40079793 AACTGAGACTCAGAGAAGTTAGG + Intronic
1147448757 17:40490799-40490821 AACTGAGGCTCAGAGAGGTTAGG - Intronic
1148210607 17:45806351-45806373 AACTGAGGCACAGAGAGGTAAGG - Intronic
1148229145 17:45920401-45920423 AACTGAGGCTCAGAGTGGCTAGG + Intronic
1148324935 17:46777741-46777763 AACTGAGGCATGGAGTAGTTGGG + Intronic
1148501914 17:48098292-48098314 AACTGAGGCTAAGACAAACATGG + Intronic
1148906592 17:50916276-50916298 AACTGAGACAAAGAGGAGTGAGG + Intergenic
1149198765 17:54157380-54157402 AACTGTGGCTTAGATTAGAAAGG + Intergenic
1149992894 17:61392618-61392640 AACGGAGGCCCAGAGTACTAGGG + Exonic
1150515940 17:65809249-65809271 AACTGAGGGGGAGAGGAGTAGGG + Intronic
1151401062 17:73856489-73856511 AACTGAGGCCAAGAGGAGGGAGG + Intergenic
1151712796 17:75816496-75816518 AACTGAGGCTCAGAGAGGTAAGG - Intronic
1151878133 17:76878920-76878942 AATTGAGGCCAAGAGAAGGACGG + Intronic
1151930647 17:77229670-77229692 AACTGAGGCTCAGAGGGGTTGGG + Intergenic
1152238043 17:79148597-79148619 AACTGAGGCTAACAGTAGTTGGG + Intronic
1152282198 17:79391410-79391432 GACTGAGGCTCAGAGAAGTTAGG - Intronic
1203192993 17_KI270729v1_random:206768-206790 AACTGAGGCTTAGAGAGGGAAGG - Intergenic
1203202357 17_KI270730v1_random:6203-6225 AACTGAGGCTTAGAGAGGGAAGG - Intergenic
1153012789 18:555083-555105 AAATGAGGCTCAGAGAAGCAAGG - Intergenic
1154486695 18:14877642-14877664 AACTGAGGCTCAGAGGTGTCAGG + Intergenic
1155085695 18:22455610-22455632 AGCTGAGGCTCAGAGCAGTTAGG + Intergenic
1155244509 18:23894521-23894543 AACTGAGGCTTGGAGAAGCAGGG - Intronic
1156216465 18:35003410-35003432 AACAGAGGCTCAGAGTAGTGGGG - Intronic
1156596520 18:38553917-38553939 AACTGAGATTAACAGTGGTAGGG + Intergenic
1157731484 18:50008123-50008145 CACTGAGGCTAAGTTTATTATGG - Intronic
1158114652 18:53981487-53981509 AACTGAGGCTCAGTGTAATTAGG + Intergenic
1160102147 18:75932792-75932814 AACTGAGGCTCAGAGAAGTTAGG + Intergenic
1160928238 19:1557070-1557092 AACTGAGGCTGAGGGAAGAAGGG - Intronic
1160943625 19:1631194-1631216 AACTGAGGCTCAGAAGAGGATGG + Intronic
1161074687 19:2279656-2279678 AACTGAGGCTTATAGGAGGATGG + Intronic
1161200259 19:3010668-3010690 AACTGAGGCTCAGAGAGGTTGGG + Intronic
1161261795 19:3341848-3341870 AACTGAGGCTGAGAGAGGAAGGG - Intergenic
1161630666 19:5353686-5353708 AACTGAGGCTCAGAGAGGAAAGG + Intergenic
1162446407 19:10725592-10725614 AACTGAGGCCCAGAGAAGTGAGG - Intronic
1163573704 19:18098446-18098468 AACTGAGGCCCAGAGAAGCAAGG - Intronic
1163584111 19:18154733-18154755 AACTGAGGCTCAGAGCAGGGAGG - Intronic
1163653308 19:18531581-18531603 AACTGAGGCATAGAGAAGTGGGG - Intergenic
1163772039 19:19197128-19197150 AACTGAGGCACAGAGAAGCAAGG + Intronic
1166089685 19:40500329-40500351 AACTGAGGCTTAGAGAAGCTAGG + Intronic
1167153359 19:47722873-47722895 AACTGAGGCACAGAGAAGTTAGG - Intronic
1167467751 19:49659047-49659069 AACTGAGGCACAGAGCAGCAAGG + Intergenic
1168322874 19:55520826-55520848 AACTGAGGCTCAGAGAAGGGAGG - Intergenic
925739869 2:6995997-6996019 AGCTGAGGCTGAGAGTGGTTAGG + Intronic
925740533 2:7001889-7001911 AACTAAGGCTCAGAGAAGTTAGG - Intronic
926301157 2:11603918-11603940 AACTGAGACTTAGAGAAGTTAGG + Intronic
926548495 2:14271763-14271785 AACTAAGGCCCAGAGAAGTAAGG - Intergenic
926978306 2:18536898-18536920 AACTGAGGCTTAGAGGGGGAAGG - Intergenic
927459146 2:23282809-23282831 AACTGAGGCACAGAGCAGTTAGG + Intergenic
927489592 2:23512115-23512137 AACTGAGGCTCAGAGAAGTTAGG - Intronic
927538810 2:23888694-23888716 AACTGAGACCATGAGTAGCAGGG + Intronic
928091265 2:28376496-28376518 AACTGAGGCAAGGAGCAGGAAGG - Intergenic
928305942 2:30170543-30170565 AACTGAGGCTTAGAGAGGTTGGG - Intergenic
928328222 2:30336892-30336914 AACTGAGGCTCAAAGCAGTTTGG + Intergenic
928365684 2:30699243-30699265 ATCTGAGGCTAAAATTTGTATGG - Intergenic
928475207 2:31618660-31618682 ACCTGAGGCTAAGGGTAAGAGGG + Intergenic
928642117 2:33310539-33310561 AACTGAGGCTCCGAGAAGTTAGG + Intronic
928750535 2:34466196-34466218 AACTAAGGAAAAGAGTAGCATGG + Intergenic
929083339 2:38143412-38143434 AACTGAAGCTAAGAGAAGAAAGG - Intergenic
929098113 2:38283092-38283114 AACTGAGGCTGAGAGTGGCAGGG - Intergenic
929345346 2:40876420-40876442 AAGTGAGGCTAAGAGAAATTCGG + Intergenic
929571164 2:43024029-43024051 AACTGAGGCTGAGGGCAGTTAGG + Intergenic
930091728 2:47535680-47535702 AACCAAGGCTCAGAGAAGTAAGG + Intronic
930587440 2:53284676-53284698 GACTGACGCTCAGAGTGGTAAGG - Intergenic
931238704 2:60433506-60433528 AACTGAGGCTGAGAGCAGTCCGG - Intergenic
931444931 2:62318827-62318849 AACTGAGGCTCAGAGGGGTAAGG + Intergenic
931604024 2:64033721-64033743 ACCTGAGGCTTAGAGAGGTAAGG + Intergenic
931919378 2:66996585-66996607 AACTGAGGCTCAGAGAGGTTAGG + Intergenic
933664865 2:84956718-84956740 AACTGAGGCTGAGAGATGTTGGG + Intergenic
933772064 2:85750944-85750966 AACAGAGGCTCAGAGAAGTCAGG + Intergenic
933979406 2:87538247-87538269 AACTGAGGCTCAGAGAGGTTGGG - Intergenic
934054469 2:88240357-88240379 AACTGAGGCTCAGAGAATTTAGG - Intergenic
936148577 2:109997753-109997775 AACTGAGGCCCAGAGAAGTAAGG - Intergenic
936196101 2:110373615-110373637 AACTGAGGCCCAGAGAAGTAAGG + Intergenic
936314419 2:111412544-111412566 AACTGAGGCTCAGAGAGGTTGGG + Intergenic
937638910 2:124189462-124189484 AACTGAGGCTCAGAGTAGTCTGG - Intronic
940560282 2:155287045-155287067 AACTGAGGTTTAGTGTAGTTTGG + Intergenic
941785894 2:169498026-169498048 AACTGAGGCTTTGAGAAGTTAGG + Intronic
941864103 2:170315763-170315785 AACTGAGGCTTAGAGGAGTTAGG + Intronic
944409776 2:199428576-199428598 AACTGAGGCAAAGAAAGGTAGGG - Intronic
945271295 2:207943019-207943041 ACCAGAGGCTAAGAAAAGTAGGG + Intronic
945323280 2:208452200-208452222 AACTGAGGCTCAGAGAGGTTAGG - Intronic
945964172 2:216168193-216168215 GACTGAGGCCCAGAGTAGTTAGG + Intronic
945984174 2:216340876-216340898 AACTGAGGCCCAGAGAAGTGAGG + Intronic
946093761 2:217253795-217253817 ATCTGAGGCTAGGAGTGTTAGGG + Intergenic
946479375 2:220039473-220039495 GACTGAGGCTAAGAGAATGAGGG + Intergenic
947549917 2:231038301-231038323 AACTGAGGCTCAGAGCAGGGAGG + Intronic
948246507 2:236490266-236490288 AACTGAGGATCAAAGAAGTAAGG + Intronic
948292656 2:236837706-236837728 AACTGAGGCTCAGAGAAGTAAGG - Intergenic
948329779 2:237155817-237155839 AACCGAGGCTCAGAGAAGCAAGG + Intergenic
1168954852 20:1827798-1827820 AACAGAGGCTCAGAGAAGTGGGG + Intergenic
1168955435 20:1831299-1831321 AACTGAAGCTCAGAGAAGGAAGG - Intergenic
1168968465 20:1914435-1914457 AACCAAGGCTGAGAGCAGTAAGG + Intronic
1169318419 20:4611682-4611704 AACTGAGGCTCAGAGAGGCATGG - Intergenic
1170716616 20:18837219-18837241 AACTGAGGCTCAGAGAGGTTAGG - Intergenic
1171048838 20:21836989-21837011 CACTAAGGCTAAGAGGAGTTAGG - Intergenic
1171161313 20:22926394-22926416 AACAGAGGCCATGAGTAGGATGG + Intergenic
1171564668 20:26170178-26170200 AACTGAGGCTCAAAGAAGTCAGG - Intergenic
1171949065 20:31404987-31405009 AACTGAGGCTAAGTGCTGTGTGG - Exonic
1172126794 20:32629253-32629275 AACTGAGGCTCAGAGAAGTGAGG + Intergenic
1172198411 20:33108076-33108098 AACTGAGGCTCACAGCAGTAAGG + Intronic
1172619755 20:36311185-36311207 AACTGAGGCTCAGAGTGGTTGGG + Intronic
1173363445 20:42364826-42364848 AACTGAGGCTCAGAGAGGTTAGG + Intronic
1173450505 20:43159416-43159438 AACTGAGGCTCAGAGAAGCTGGG - Intronic
1173569269 20:44066222-44066244 AACTGAGGCTCAGAGAGGTCAGG - Intronic
1173626301 20:44475679-44475701 AACTGAGGCTCAGAGAAGGAAGG - Intergenic
1173689354 20:44948077-44948099 AATTGAGGCTCAGAGAAGGAAGG - Intronic
1173826324 20:46050021-46050043 AACTGAGGCTTAGACAAGTCAGG + Intronic
1173833188 20:46106403-46106425 AATTGAGGCTCAGAAGAGTAGGG + Intergenic
1173935482 20:46858425-46858447 AACTGAGGCTTAGAGAGGTTAGG - Intergenic
1174039546 20:47689139-47689161 AACTGAGGCACAGAGAGGTAAGG - Intronic
1174175622 20:48642649-48642671 AACTGAGGCTCAGAGAGGTCAGG - Intronic
1174191267 20:48742413-48742435 AACTGAGGCACAGAGAGGTAAGG + Intronic
1174363927 20:50044842-50044864 AACTGAGGCTCAGAGAGGTAAGG - Intergenic
1174562120 20:51438830-51438852 AACTGAGGCCCAGAGAAGCAAGG + Intronic
1174882226 20:54292535-54292557 AACTGAGGCTCAGAGAAATTTGG - Intergenic
1175333908 20:58182693-58182715 AACTGAGGCTCAGAGATGTAAGG - Intergenic
1176794607 21:13361757-13361779 AACTGAGGCTCAGAGGTGTCAGG - Intergenic
1178862129 21:36298220-36298242 AACTGAGGCTCAGAGAAGCAGGG + Intergenic
1178930697 21:36816137-36816159 AACTGAGGCTAAGAGTAGTATGG - Intronic
1179935075 21:44598479-44598501 AAATAAGGCTCAGAGTCGTAAGG - Intronic
1180551515 22:16545431-16545453 AACTGAGGCCCAGAGAAGTAAGG + Intergenic
1180744067 22:18075067-18075089 AACTGAGGCACAAAGAAGTATGG + Intergenic
1180898999 22:19357454-19357476 AAGGCAGGCTAAGAGAAGTATGG + Intronic
1181352487 22:22268492-22268514 AACTGAGGCCCAGAGAAGTAAGG - Intergenic
1181659713 22:24335356-24335378 AACTGAGGCAAAGAGTAGGCAGG - Intronic
1181785720 22:25225250-25225272 AACTGAGGCTCAGAGGGGGAAGG - Intronic
1181968289 22:26671718-26671740 AACTGAGGTTGAGAGAAGTGAGG - Intergenic
1181996305 22:26885629-26885651 AACTGAGGCTCAGAGAGGTTTGG - Intergenic
1182043505 22:27256945-27256967 AACTGAGGCCTAGAGTGGTTAGG + Intergenic
1182068653 22:27447743-27447765 GACTGAGGCTCAGAGAAGAATGG - Intergenic
1182071591 22:27467389-27467411 AACTGAGGCCCAGGGTAGAATGG - Intergenic
1182432312 22:30307011-30307033 AACTGAGGATCAGAGAAGAAAGG - Intronic
1182464211 22:30504470-30504492 AACTGAGGCTTAGAGAGGTTTGG - Intronic
1182680442 22:32075249-32075271 AACTGAGTCTCAGAGAAGTTAGG + Intronic
1183316657 22:37140889-37140911 CACTGAGGCTCAGAGAGGTATGG - Intronic
1183885393 22:40876517-40876539 AACTGAGGCACAGAGAAGTTTGG + Intronic
1183984659 22:41562761-41562783 ATGGGAGGCTAAAAGTAGTAGGG + Intronic
1184405257 22:44297265-44297287 AACTGAGGCTCAGAGACCTAAGG + Intronic
949699792 3:6743405-6743427 AACTGAGGCTCAGAAGAGTTTGG + Intergenic
949795821 3:7849641-7849663 AACTGAGGCTTAGATTATTTAGG - Intergenic
950106292 3:10391198-10391220 AACTGAGGCTCAGAGTGGAGGGG + Intronic
950116770 3:10455832-10455854 AACTGAGGCCCAGAGAAGAAAGG - Intronic
950121544 3:10485299-10485321 AACTGAGGCTCAGAGAGGTGAGG + Intronic
950645070 3:14372169-14372191 AACTGAGGCTAAGAGAGGCAAGG - Intergenic
950674520 3:14546485-14546507 AAATGAGGCTCAGAGCAGAAGGG - Intergenic
951709126 3:25571727-25571749 AACTGAGGCTGAGAGACGTTAGG - Intronic
952743961 3:36760918-36760940 AACCGAGGCTCAGAGTAGTTGGG + Intergenic
953316718 3:41934608-41934630 AACTAAGGCAAAGAGAAGCAGGG + Intronic
953345157 3:42169506-42169528 AACTGAGGCTCTGAGAAGTCAGG - Intronic
953449240 3:42992330-42992352 AACTGAGGCTAAGAGGTTAAAGG - Intronic
953550204 3:43896198-43896220 AACTGAGGCTCAGAGACTTAAGG + Intergenic
953905918 3:46868243-46868265 AACTGAGGCCAAGAGGAGCAGGG - Intronic
953907612 3:46876166-46876188 AACTGAGGCCATGAGCAGGAAGG + Intronic
954446779 3:50551110-50551132 AACTGAGGCACAGGGCAGTAGGG - Intergenic
954888707 3:53902896-53902918 AAATGAGGCTAAGACTTGTTGGG - Intergenic
955207622 3:56910923-56910945 AACTGAGGCCCAGAGAGGTAAGG + Intronic
955732463 3:62000964-62000986 AACTGAGGCACAGAGAAGTTGGG + Intronic
955993903 3:64658179-64658201 AACTGAGTCTCAGAGGAGTTAGG - Intronic
956728902 3:72178499-72178521 AACTGAGGCTCGGAGAAGTTAGG + Intergenic
956876979 3:73473680-73473702 AACAGAGGCTCAGAGAAGTTAGG + Intronic
956902303 3:73729612-73729634 AATTGAGGCTCAGAGAAGTTAGG + Intergenic
957705285 3:83772266-83772288 AACTGAGGCTACCAGAAGTGAGG - Intergenic
958652079 3:96949410-96949432 AACTGAGGCATAGAGTGGTTAGG - Intronic
958867015 3:99512746-99512768 AACTAAGGCTAGGAGCAGAAAGG + Intergenic
959614151 3:108328515-108328537 AACTGAGGCAAAAAGGAGTTAGG + Intronic
959951331 3:112183976-112183998 AATTGAGGCTAGGAGAGGTAGGG - Intronic
960383866 3:116995966-116995988 AGTTGAGGCAAAGAGTGGTAGGG - Intronic
960694529 3:120383182-120383204 AACAGAAGCTCAGAGTAGAAGGG + Intergenic
960946307 3:122969172-122969194 AACTGAGGCTCAGAGAGGTTGGG + Intronic
960997235 3:123348257-123348279 ACCTGAGGCTCAGAGAAGTTTGG - Intronic
961338218 3:126198301-126198323 AACAGAGGCTAAGACAAGCAGGG - Intergenic
961362566 3:126377262-126377284 AACTCAGGCCAAGAGTAAAATGG + Intergenic
961424201 3:126832130-126832152 AACTGAGGCTCAGAGAGGCAAGG + Intronic
961441560 3:126956431-126956453 AACTGAGGCTCAGAGAATTAAGG - Intronic
962985912 3:140535748-140535770 AACTGAGGCTCAGAGATGAAGGG + Intronic
964221266 3:154347994-154348016 AACTGAGGCTTACAGAAGTAAGG - Intronic
964495534 3:157285867-157285889 AACTGAGGCACAGAGAGGTATGG - Intronic
964593056 3:158388469-158388491 AAATGAGGCTTAGAGAAGTTAGG + Intronic
965157193 3:165077291-165077313 AACTGTGCCTCAGAGTGGTAAGG - Intronic
965313305 3:167158877-167158899 AACTGTGGCTTGGAGTAGTATGG + Intergenic
965900269 3:173631518-173631540 AACAGAGGCTACCAGGAGTAAGG + Intronic
966123991 3:176553901-176553923 AACTGAGACTGAGAGAAGTTAGG - Intergenic
966406044 3:179599501-179599523 AGCTAAGGCTGAGAGAAGTAAGG + Intronic
966884792 3:184371157-184371179 AACTGAGGCTCAGAGAAGCCAGG - Intronic
966971273 3:185047747-185047769 AATTGAGGCTTAGAGAAGTGAGG + Intronic
967457483 3:189705252-189705274 AACTGAGGCTCAGAATGGTTAGG - Intronic
967478120 3:189944136-189944158 AACTGAGGCTCAGAGAAGTTGGG - Intergenic
967833378 3:193941336-193941358 AACTGAGGCTCAGAGAGGTTGGG - Intergenic
969173539 4:5382856-5382878 AACTGAGGCTCAGAGAGGTCAGG + Intronic
969321295 4:6414645-6414667 AACCGAGGCTCAGAGAAGCAAGG + Intronic
969505076 4:7581037-7581059 AACTGAGGCTCATAGAAGAAAGG + Intronic
969552544 4:7880605-7880627 AACTGAGGCCCAGAGAAGAAAGG + Intronic
970114951 4:12684459-12684481 AACTGAGGTTGAGAGAACTATGG - Intergenic
970116613 4:12703573-12703595 AACTGAGGCTCAGAGAAGTCAGG - Intergenic
970559022 4:17264815-17264837 AACTGAAGCTAAGAGAGGTGAGG + Intergenic
971182465 4:24342378-24342400 AACTGAGGCTAATAGAGGTTAGG + Intergenic
971218801 4:24686433-24686455 AACTGAGGCTTAGAGGGGTGAGG + Intergenic
971274227 4:25180539-25180561 AACTGAGGCTCAGAGAGGGAAGG + Intronic
971986479 4:33831387-33831409 AACTGAGGCTCAAAGAAGTCAGG + Intergenic
972356406 4:38283066-38283088 AACTGAGGCTTAGAGAAGCCTGG - Intergenic
973117494 4:46479179-46479201 AACTGAGACTAAGAAAAATAAGG + Intergenic
975576597 4:75869110-75869132 ATCAGAGGCTAACAGAAGTATGG + Intronic
976259465 4:83131805-83131827 AAATGAGGGTAAGAGAAGGAAGG - Intronic
976541842 4:86286569-86286591 AACTGAGGCAGAGAGAAGTGAGG + Intronic
977320946 4:95515338-95515360 AACTGAGGCTCAGAATGTTAAGG + Intronic
978806048 4:112801542-112801564 AACTTAGGCTAAGGGGATTAGGG + Intergenic
980523280 4:133958513-133958535 AACTGATGCCAGGAGTAGTGGGG - Intergenic
980728132 4:136791464-136791486 GACAGAGACTGAGAGTAGTAGGG + Intergenic
981951306 4:150411283-150411305 AACTGAGGATAAGAGTCGTTGGG + Intronic
982721252 4:158862340-158862362 AAATGAGGCTGAGAGTAATAAGG - Intronic
984761170 4:183364181-183364203 AACTGAGGGGAAGAGCACTAGGG + Intergenic
984814917 4:183827044-183827066 AACTGAGGCACAGAGTGGTTAGG + Intergenic
986340266 5:6783127-6783149 AGCTGAGTCTCAGAGTAATATGG - Intergenic
986451046 5:7865919-7865941 GACTGAGGCTAAGAAAAGTTGGG + Exonic
988697622 5:33639066-33639088 AACTGAGGCTCAGAGAAATGAGG - Intronic
990228261 5:53681274-53681296 AACTGAGGCTCAGAGAGGTTAGG - Intronic
990763088 5:59152134-59152156 AACTGAGGCTCAGAGAATTTAGG - Intronic
990846098 5:60141439-60141461 TACTGAGGCAGAGAGTAGAAGGG + Intronic
992207999 5:74449589-74449611 AACTGAGGCTCAGAGGGGTTAGG + Intergenic
992306573 5:75446162-75446184 AACAGAGCCTAAGAGAACTATGG - Intronic
992510738 5:77431958-77431980 AACTGAGGCCCAGTGCAGTAAGG - Exonic
992779781 5:80117280-80117302 AACTGAGGCTCAGAGAGGTGAGG - Intronic
992983030 5:82196889-82196911 AACTGATGCTAAGATTCATATGG - Intronic
993012023 5:82493473-82493495 AACTGGGGCAAAGAGCAGTTTGG - Intergenic
993838863 5:92850896-92850918 AACTGAGGTTAAACGAAGTAAGG - Intergenic
995256253 5:110050097-110050119 AACTGAGGTAAAGAGTGGAAAGG - Intergenic
995421172 5:111968712-111968734 AACTGAAGCTAGAAGTAGTGGGG - Intronic
996372455 5:122767951-122767973 AACATAGGCTCAGAGTTGTAGGG + Intergenic
996873792 5:128219186-128219208 AACGGAGGTTTAGAGAAGTAAGG + Intergenic
997013856 5:129906776-129906798 CAATGAGGCTACGAGTAGAAAGG - Intronic
997227793 5:132222389-132222411 GACTGAGGCTAAGGAGAGTAGGG - Intronic
997404800 5:133636922-133636944 AACTGAGGCTCAGAGAGGTTAGG + Intergenic
997930540 5:138069113-138069135 AACTCAGGCTATGAGGAGAAGGG + Intergenic
997983928 5:138488844-138488866 AACTGAGGTTCAGAGAAGTAGGG - Intergenic
998850189 5:146344454-146344476 CACTGAGGGTCAGAGCAGTAAGG - Intergenic
998859659 5:146429793-146429815 AACTGAGGCTCCTAATAGTATGG + Intergenic
999734500 5:154502739-154502761 AACTGAGGCTCAGAGAACTTAGG - Intergenic
1000775113 5:165410061-165410083 AACTGGGGCTTAGCCTAGTAGGG + Intergenic
1001145274 5:169178331-169178353 AACTGAGGCAGGGAGCAGTAGGG - Intronic
1001227461 5:169957509-169957531 AACTGAGGCTCAGAGGTGTCAGG + Intronic
1001570943 5:172730087-172730109 AACTGAGGCTCAGAGAGGCAAGG + Intergenic
1001910763 5:175515622-175515644 AGCTGAGGCTCAGAGAAGTTAGG + Intronic
1001936342 5:175708545-175708567 AACTGAGGCTCAGAGAAGTAAGG + Intergenic
1002876447 6:1215187-1215209 AACCGAGTCTAAGAGTAAGATGG - Intergenic
1003092567 6:3116377-3116399 AACTGAGGCTAAGAAAGGTTAGG - Intergenic
1003376726 6:5585501-5585523 AACTGAAGCAAAGAGTAGAAAGG - Intronic
1004376787 6:15097435-15097457 AACTGAGGCTTAGAGAGTTAGGG - Intergenic
1006021336 6:31119522-31119544 CACTGAGGCTCAGAGAAGTTAGG - Intronic
1006110936 6:31744781-31744803 AACTGAGGCAAAGAAAAGTAAGG + Intronic
1006787380 6:36677792-36677814 AACTGGGGCTCAGAGAAGTCTGG - Intronic
1007490463 6:42217484-42217506 AACTGAGGCTCAGAGAAGACAGG - Intronic
1007545730 6:42692729-42692751 AACTGAAGCTAAAAGAAGTGAGG + Exonic
1007733769 6:43967796-43967818 AACTAAGGCTCAGAGAAGTGAGG + Intergenic
1007812136 6:44493948-44493970 AACTGAGGCTCAGAAAAGTTAGG - Intergenic
1007996815 6:46316363-46316385 AACCGAGGCACAGAGCAGTAAGG + Intronic
1008921324 6:56846280-56846302 AACTGAGGCTAAGATAAGTTTGG + Intronic
1009229669 6:61046819-61046841 AAGTGAGCTTAAGAGTACTAAGG - Intergenic
1010398590 6:75421841-75421863 AACTGAGGCTCAGAGTCACACGG + Intronic
1011187405 6:84693650-84693672 AACTGAGGATAAAAGAATTAAGG - Intronic
1013644654 6:112124516-112124538 AACTGAGTCTCAGTGTTGTATGG - Intronic
1014086875 6:117356258-117356280 AACTGAGGCTGAGAAAAGTAAGG - Intronic
1016010568 6:139134795-139134817 AATTGAGGCTTAGAACAGTATGG - Intergenic
1016332695 6:142970523-142970545 AACTGACTCTAAAATTAGTATGG - Intergenic
1016485583 6:144534326-144534348 AACTGAGGCTAAGAGAGGCGAGG + Intronic
1016661499 6:146586174-146586196 ATCTGAGGCTAGGAGTAGATGGG - Intergenic
1019501863 7:1368782-1368804 AACTGAGGCTGAGAGGACCAAGG + Intergenic
1022331321 7:29382015-29382037 AACTGAGGCACAGAGAAGCAAGG - Intronic
1022474069 7:30699128-30699150 AACTGAGGCTCAGAGTGGTAGGG - Intronic
1023346859 7:39279362-39279384 AACTGAGGCTCAGAAAGGTAAGG - Intronic
1023681765 7:42694646-42694668 AAATGAGGATAAGACTACTACGG + Intergenic
1024464668 7:49699772-49699794 AAGTGAGGCTCAAAGCAGTATGG - Intergenic
1024548847 7:50543712-50543734 AACTGAGGCTCAGAGAGGTTAGG - Intronic
1027512265 7:79097590-79097612 AACAGAGGCTAAGAGAAATAAGG + Intronic
1028965205 7:96794421-96794443 AACTGAGGCTCAGAGTGGTTTGG - Intergenic
1030184085 7:106742558-106742580 ATCATAGGCTCAGAGTAGTATGG + Intergenic
1030989704 7:116285478-116285500 AATTGAGGCTAAGAGAAGTTGGG - Intergenic
1032567751 7:132965131-132965153 TACTGCAGCTAAGAGTAGAAAGG - Intronic
1033924948 7:146446526-146446548 CACTGAGGCAAAGAATAATAGGG - Intronic
1034441890 7:151089881-151089903 AACTGAGGCTCAGAGAAGGGAGG + Intronic
1036689008 8:10929631-10929653 AACTAAGGCTCAGAGAAGTTAGG - Intronic
1036751274 8:11444891-11444913 AACTGAGGCTCAGAGTGGACTGG + Intronic
1038327239 8:26580310-26580332 AACTGAGGCTCAGAGAGGTTAGG - Intronic
1038422065 8:27439842-27439864 AACTGAGGCTCAGATGAGTCAGG + Intronic
1038538512 8:28372104-28372126 AACTGAGGCACAGAGTGGTGAGG - Intronic
1038774073 8:30512381-30512403 AACTCATGTTAAGAATAGTATGG - Intronic
1039468891 8:37801719-37801741 AACTGAGGCCAGGAGAAGAAGGG + Intronic
1039927873 8:41954701-41954723 AACTGAGGCACAGAGCAGTTGGG + Intronic
1040387314 8:46922246-46922268 AGCTGAGGCTCAGAGGAGTGAGG + Intergenic
1040424376 8:47270244-47270266 AGCTGAGGCTCAGAGTACAACGG - Intronic
1042058933 8:64796530-64796552 AATTGAGACTTAGAGTAGTTTGG + Intronic
1042632782 8:70838567-70838589 AACTGAGGCTCAGAGACGTTAGG + Intergenic
1042742796 8:72069695-72069717 AGCTGAGGTTCAGAGAAGTATGG - Intronic
1042817217 8:72890693-72890715 CACTGAGGCTCAGAGAAGTCAGG + Intronic
1043167164 8:76917793-76917815 AACTGTGCCTAAAAGTAGTATGG + Intergenic
1043752174 8:83951546-83951568 GAGAAAGGCTAAGAGTAGTATGG - Intergenic
1044989223 8:97780668-97780690 AACTGAGGCTTAGAGAACTTTGG + Intronic
1045267476 8:100632031-100632053 AACTGAGGCTCAGAGAAGGTAGG + Intronic
1047057035 8:121176709-121176731 AACTTGGGCTTAGAGAAGTACGG - Intergenic
1047119363 8:121883535-121883557 AACTGAGGCACAGAGAAGTTAGG + Intergenic
1047162218 8:122393128-122393150 AACTGAGGCTCAGAAAAGTTAGG - Intergenic
1047391528 8:124455861-124455883 AAGTGAGGGTAGGAGGAGTAGGG + Intronic
1047774041 8:128054430-128054452 AACTGAGGCTCAGAGAGGTGAGG + Intergenic
1047970338 8:130078838-130078860 AACTGAGGATAATAGTAATTGGG + Intronic
1048005272 8:130414486-130414508 AACTGAGGTTCAGAGAGGTAAGG - Intronic
1048063451 8:130944184-130944206 AACTGAGGCTCAGAGATGCAAGG + Intronic
1048276965 8:133073845-133073867 AAATGAGGCTCAGAGAAGTTAGG - Intronic
1048572640 8:135668107-135668129 AACAGAGGCTCAGAGGATTATGG - Intergenic
1048608600 8:135997082-135997104 AACTGAGGCTTAGAGAGGTGAGG - Intergenic
1048976339 8:139674940-139674962 CAGTGAGGCTAAGAGGGGTAGGG - Intronic
1049234853 8:141507404-141507426 AACTGAGGCCCAGAGAAGGAAGG - Intergenic
1050161904 9:2727818-2727840 AACTGAGGCCAAGAGAATTTAGG + Intronic
1050461004 9:5877353-5877375 AACTGAGGCTCAGAATGGTTAGG + Intergenic
1051357073 9:16249422-16249444 AACTGAGGCACAGAGAAGTTAGG - Intronic
1051656487 9:19386603-19386625 TACAGAAACTAAGAGTAGTATGG + Intergenic
1052706856 9:32004468-32004490 AACTCAGGATAAGAGTTGGAGGG + Intergenic
1053561852 9:39204449-39204471 AACTGTGATTAAGAATAGTAGGG + Intronic
1054135266 9:61414503-61414525 AACTGTGATTAAGAATAGTAGGG - Intergenic
1054942152 9:70754916-70754938 AACTGAGGCTAAGAGAGGTGGGG - Intronic
1055466457 9:76571337-76571359 AACTGAGGCTTATAGCAGTTTGG + Intergenic
1055641488 9:78321809-78321831 AACTGTGGCTTAGAGCAGTTAGG - Intronic
1055857178 9:80703247-80703269 AATTGATGCTAATAGAAGTATGG + Intergenic
1055935582 9:81601491-81601513 AACTCAGGCTAATAATAGTTTGG - Intronic
1056119185 9:83470387-83470409 AACTGAGGCTCAGATAAGTTAGG - Intronic
1057097679 9:92326637-92326659 AACTGAGGCTCAGAGAAGTTAGG + Intronic
1057117492 9:92539657-92539679 AAGTGAGGGGAGGAGTAGTATGG + Intronic
1057520545 9:95756278-95756300 AACTGAGGTTCAGAGAAGTTAGG + Intergenic
1057754567 9:97821728-97821750 AGCTGAGGCTAAGAGAGGAAAGG + Intergenic
1057801486 9:98193738-98193760 AACTGAGGCTTGGAGTGGCAAGG + Intergenic
1057858116 9:98617920-98617942 AACGGAGGCTCGGAGTGGTAAGG - Intronic
1057937821 9:99255770-99255792 AACTGAGGCTCAGAGAGGCAAGG + Intergenic
1057963489 9:99479541-99479563 AAGTGAGGCTCAGAGTGGTTAGG - Intergenic
1058164628 9:101605948-101605970 AACTGAGGCTCAGAGAGGTTAGG + Intronic
1058425676 9:104873846-104873868 AACTGAGGCACAGAGATGTATGG + Intronic
1058501971 9:105629261-105629283 AACTGATGCTAAGAGAAAAAGGG + Intronic
1058935182 9:109763416-109763438 AACTGAGGCACAGAGAAGTTAGG - Intronic
1059459914 9:114423176-114423198 AACTGAGGCTCAGAGAGGCAAGG + Intronic
1059993709 9:119889251-119889273 AACTGAGGCTCAGAAAGGTAAGG - Intergenic
1060109455 9:120896071-120896093 AACTGAGGCTCAGAGAGGTGAGG - Intergenic
1060150474 9:121285108-121285130 AACTGAGGCTGAGAAGAGTAAGG - Intronic
1060269192 9:122128950-122128972 AACTGAGGCACAGAGAAGTCTGG - Intergenic
1060672097 9:125478820-125478842 AACTGAGGCTTGGAGGAGTTTGG - Intronic
1060728509 9:126022117-126022139 AATTGAGGCTGAGAGAAGTGAGG - Intergenic
1060938802 9:127531559-127531581 AACTGAGGCCCAGAAAAGTAAGG + Intronic
1060990690 9:127847038-127847060 AACTGAGGCTCAGAGAGGTTAGG - Intronic
1060996683 9:127878002-127878024 AACTGAGGCTCAGAGAAGAGCGG + Intergenic
1061054314 9:128214317-128214339 AACTGAGGCTCAGAGAGGTATGG + Intronic
1061291888 9:129655108-129655130 AACTGAGGCTCGGAGAAGAAAGG - Intergenic
1061320694 9:129826916-129826938 AACTGAGGCTAAGAGTGAAAAGG + Intergenic
1061397902 9:130353398-130353420 AACTGAGGCCAGGAGTGGAAGGG + Intronic
1061488172 9:130930767-130930789 AACTGAGGCTCAGAGAGGTGAGG - Intronic
1062170054 9:135129710-135129732 AACTAAGGCTGGGAGTAGTCAGG + Intergenic
1062284078 9:135765402-135765424 AACTGAGGCTGAGAGGACTCAGG - Intronic
1186252001 X:7678318-7678340 AACAGAGGCTAAGAGGAGAGAGG - Intergenic
1187232712 X:17437697-17437719 AACTGAGGCTTAGTGTGGTTAGG - Intronic
1187734902 X:22293443-22293465 AACTGAGGCCCAGAGAAGTTAGG + Intergenic
1189756040 X:44272137-44272159 ATCTGTGGCTGAGAGGAGTATGG + Intronic
1190524569 X:51315563-51315585 AACTGAGACCCAGAGAAGTAAGG - Intergenic
1190545760 X:51524771-51524793 AACTGAGACTCAGAGAAGTAGGG + Intergenic
1190729935 X:53219029-53219051 AACAGAGGCTCAGAGGAGTTAGG + Intronic
1190940090 X:55031600-55031622 AACTGAGGCTCAGAGAGGTGAGG + Intergenic
1191859605 X:65655310-65655332 AACTGAGGCTCAAGGAAGTAAGG - Intronic
1192047593 X:67692609-67692631 AACTGAGGCTCAGAGAGGTCTGG - Intronic
1192799132 X:74449238-74449260 AATGGAGGCTTAGAGGAGTAAGG - Intronic
1193909573 X:87285885-87285907 AATTGAGACGAAGTGTAGTATGG + Intergenic
1195596362 X:106695383-106695405 AACTTATGTTAAGAATAGTATGG + Intronic
1195672088 X:107478343-107478365 AACTGAGGCCCAGAGAGGTAAGG + Intergenic
1197144502 X:123156515-123156537 ATCTGAGCCTAAGAGTATTGGGG - Intergenic
1197760939 X:130027768-130027790 AACTGAGGCTCAGAGCAATTAGG + Intronic
1198162188 X:134018817-134018839 AACTGAGGCTTAGAGAAGTATGG - Intergenic
1199671859 X:150154446-150154468 AACTGAGGCCTAGAGAAGGAAGG - Intergenic
1199940885 X:152626614-152626636 AACTGAGGCACAGAGAAGTTAGG + Intergenic
1201715125 Y:17036097-17036119 AACTGAGGCAGGGAGGAGTATGG + Intergenic
1202053883 Y:20808610-20808632 AAATGTGGCTAAGAGTAAAATGG - Intergenic