ID: 1178932229

View in Genome Browser
Species Human (GRCh38)
Location 21:36829740-36829762
Sequence CTCTGGGAAGGGAATAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 364}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178932229_1178932237 21 Left 1178932229 21:36829740-36829762 CCCACTCTATTCCCTTCCCAGAG 0: 1
1: 0
2: 5
3: 45
4: 364
Right 1178932237 21:36829784-36829806 GTGAAGCCAGCCCCTCTCCCCGG 0: 1
1: 0
2: 2
3: 35
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178932229 Original CRISPR CTCTGGGAAGGGAATAGAGT GGG (reversed) Intronic
901451373 1:9338637-9338659 GTCTGGGAAGGGAATCGTGCTGG + Intronic
902110543 1:14074600-14074622 ATCTGGGAGGGGACTAGAGCAGG + Intergenic
903212386 1:21825596-21825618 CTCTGGCAGGGGACAAGAGTAGG + Intronic
903832257 1:26182409-26182431 CTGTGGGGTGGGAAGAGAGTGGG + Intronic
904584223 1:31570562-31570584 CCCTGGGAAAGAAATACAGTGGG - Intergenic
904873057 1:33633818-33633840 ATCTGGGAAAGGAACAAAGTTGG - Intronic
907757813 1:57327786-57327808 CTCTGGCAAAGGAATTGATTTGG - Intronic
907819179 1:57950360-57950382 GTCTGGGAAGGGAAGCTAGTGGG - Intronic
908612606 1:65879221-65879243 AGCAGGGAAGGGAAAAGAGTGGG + Intronic
908994539 1:70135480-70135502 CTGTGGGAAGAGAAGAGAGCAGG + Intronic
911509861 1:98798444-98798466 GTCTGGGAAGGGAAGAGGGAAGG - Intergenic
911549560 1:99263235-99263257 CTCTGGTAAGGGCAGAGAATTGG + Intergenic
911642843 1:100307237-100307259 CTCTAGGAAAGGAAAAGAGAAGG - Intergenic
911902121 1:103519924-103519946 GTATGGGAAGAGAATAGAGGAGG + Intergenic
912509434 1:110178517-110178539 CTTTGGGAAGGGAAGGGAATGGG - Intronic
913675603 1:121137595-121137617 CTATGGGAAGAGTATAGTGTTGG + Intergenic
914027499 1:143925536-143925558 CTGTGGGAAGAGTATAGTGTTGG + Intergenic
915465538 1:156095743-156095765 GTGTGGGGAGGTAATAGAGTGGG - Intronic
915558941 1:156675480-156675502 CTCTGGGCAGGGAATAGGGTAGG - Intronic
917539900 1:175902174-175902196 AGCTGGGAAGGGGATTGAGTGGG - Intergenic
918786492 1:188769954-188769976 CTCTAGCAAGGGCATAGAATGGG + Intergenic
919910784 1:202109393-202109415 CTTTGGGCAGGGCCTAGAGTAGG - Intergenic
920462967 1:206156431-206156453 CTGTGGGAAGAGTATAGTGTTGG + Intergenic
920956538 1:210624831-210624853 CACTGGGCAGGGAACAGAGCAGG - Intronic
920966934 1:210708858-210708880 CCCTGGGAAGGGCATAGGGCAGG + Intronic
922326491 1:224533163-224533185 CTCTGGCAAAGTCATAGAGTTGG + Intronic
922578764 1:226681460-226681482 CCCTGGCAAGGGCACAGAGTTGG + Intronic
923232396 1:231999497-231999519 CTCTGGGAGGGGAAGGGAGTTGG - Intronic
924056151 1:240126371-240126393 ATCAGGGAAGGGAACAAAGTGGG - Intronic
924598625 1:245468355-245468377 GTCTGGGAAGGGGACAGAGAGGG - Intronic
924654048 1:245956715-245956737 CTCTGGGAAGGGTTTAGTGATGG + Intronic
924671774 1:246135220-246135242 CTCTGTGAATGGTTTAGAGTAGG + Intronic
1063131885 10:3185453-3185475 AGCTGGAAAGGGAATGGAGTGGG - Intergenic
1063333703 10:5188305-5188327 CACTGTGAAGGGAAAAAAGTAGG + Intergenic
1063823918 10:9872087-9872109 CTCGGGGAAGGCAATAGAATGGG + Intergenic
1064330565 10:14390261-14390283 CGCTGGGAAGGGAGTAGGATGGG - Intronic
1064848877 10:19687516-19687538 CTCTGTGAAGGTAATTCAGTGGG - Intronic
1065011741 10:21427247-21427269 AGCTGGAAAGGGGATAGAGTTGG + Intergenic
1065012601 10:21432893-21432915 CTCTGGGAAGGGACTAGAGAGGG + Intergenic
1065843751 10:29727922-29727944 CTCAGGGTTGGTAATAGAGTAGG - Intronic
1066281016 10:33918452-33918474 AGCTGGAAAGGGAATGGAGTGGG + Intergenic
1067189718 10:44059250-44059272 CTCTGGGAAGGTAACTGAGCAGG + Intergenic
1067190282 10:44062782-44062804 CACTAGGAAGGGATGAGAGTTGG - Intergenic
1070380933 10:75879581-75879603 CTGGGGGAAGGGAAGAGACTGGG + Intronic
1071095107 10:81964074-81964096 CTCTGGGAAGGGATTAGCATGGG - Intronic
1071300395 10:84252128-84252150 TTCAGGGAAGGGACTAGAGGAGG + Intronic
1071922166 10:90362739-90362761 CAGTGAGAAGGGAATAGATTTGG - Intergenic
1072009463 10:91290830-91290852 CTCTGGGGAGGGCGGAGAGTGGG - Intergenic
1073042556 10:100617511-100617533 CTCTGGGAAGGGAGTGGAGATGG + Intergenic
1073584149 10:104692523-104692545 CACTGGGATGGGCATACAGTGGG + Intronic
1073891822 10:108111352-108111374 CTCTGAGAGGGGAATGAAGTAGG - Intergenic
1074298782 10:112214570-112214592 CCCTGAGTAGGGAATACAGTGGG + Intronic
1075333488 10:121592398-121592420 CTCTGGGAAGGGAATCTGGTAGG - Intronic
1076102510 10:127794392-127794414 AGCTGGAAAGGGAATGGAGTGGG - Intergenic
1079486732 11:20942706-20942728 TTCTAGGAAGGGAAAACAGTTGG + Intronic
1081005102 11:37726364-37726386 CTCTGGGAAGGAAATATCCTGGG + Intergenic
1081653568 11:44841721-44841743 CCCTGGGACAGGAATAGATTTGG + Intronic
1081825837 11:46050562-46050584 CTCTGGGAGGGGAATGAAGTAGG + Intronic
1083367293 11:62148889-62148911 TACTGGGAAGAGAATAGAGTGGG - Intronic
1083431650 11:62616488-62616510 CTCGGGTAAGGGAATGGAGATGG - Exonic
1084093568 11:66895121-66895143 TTCTGGGGAGGGAAAAGTGTGGG + Intronic
1085331337 11:75654346-75654368 CACTGGGAAGGAAAAAGATTAGG - Intronic
1085982083 11:81737281-81737303 CTCAGGGATGGTAATAGGGTGGG + Intergenic
1085997816 11:81942789-81942811 CTCTGCCAATGGAATAGAGAAGG + Intergenic
1086874748 11:92082049-92082071 GTCTGGGAAGGTAAGGGAGTGGG + Intergenic
1087638255 11:100727535-100727557 CTCTGGGAAGGGGAGAGGGCTGG + Intronic
1088818211 11:113435532-113435554 CCCTGAGAAGGGAACACAGTGGG + Intronic
1089215007 11:116829949-116829971 CTCTGGGGAGGGGAAAGAGGAGG + Intronic
1090513321 11:127398562-127398584 CTCTGGGATGGGAAGACAGGGGG - Intergenic
1091445694 12:543232-543254 GGCTGGGAATGGGATAGAGTGGG + Intronic
1091838346 12:3601799-3601821 CTCTGTGAGGGGAGAAGAGTGGG + Intergenic
1093277539 12:17148508-17148530 CTCAGGGAAGGGGATGAAGTGGG + Intergenic
1094018977 12:25894200-25894222 CTCTTGGAAGTGGATAGCGTGGG + Intergenic
1094055848 12:26269002-26269024 CTCTGGGGAGGGAAAAGGGGTGG - Intronic
1094412600 12:30182925-30182947 AGCTGGAAAGGGAATGGAGTGGG - Intergenic
1094421331 12:30274189-30274211 GTTTGAGAAGGGAATAGAATTGG - Intergenic
1094474977 12:30833874-30833896 CGCTGGAAAGGGGATGGAGTGGG - Intergenic
1094556648 12:31506982-31507004 CTCTGGAGAGGGAAAGGAGTTGG - Intronic
1095676301 12:44922806-44922828 CTCTAGGGAGGTAATACAGTAGG + Intergenic
1096778182 12:53976342-53976364 CTCTGGGAAGGGAGCAGGGTGGG - Exonic
1098397457 12:70036209-70036231 CTTTGGGAAGAGAAAAGAGCGGG - Intergenic
1098554628 12:71804426-71804448 AGCTGGAAAGGGAATGGAGTGGG - Intergenic
1099195441 12:79609649-79609671 AGCTGGAAAGGGGATAGAGTGGG - Intronic
1100131749 12:91502748-91502770 AGCTGGAAAGGGGATAGAGTGGG + Intergenic
1100343049 12:93699983-93700005 AGCGGGGAAGGGAATAAAGTAGG + Intronic
1101265402 12:103079995-103080017 CTCTGGGACGGCGGTAGAGTTGG + Intergenic
1101377567 12:104184166-104184188 AGCTGGGAAGGGGATGGAGTGGG + Intergenic
1101910747 12:108858579-108858601 CTCAGGGAAGGGAAGAGGGGAGG + Intergenic
1103445089 12:120989199-120989221 CTGTGGGACGGGAGTAGACTTGG + Intronic
1106208680 13:27621564-27621586 CACTGGGAAGGGAAGTGATTTGG + Exonic
1106621419 13:31374399-31374421 CTCTGTGAGGGGAATGGAGCAGG - Intergenic
1107819020 13:44269553-44269575 CTCTGGTAGAGGAATACAGTTGG - Intergenic
1108173848 13:47772519-47772541 CTCTGGGAAGGGCACAGAACTGG - Intergenic
1109066439 13:57700148-57700170 GTGTGGGAAGAGACTAGAGTTGG + Intronic
1110071332 13:71182595-71182617 AACTGGAAAGGGGATAGAGTGGG + Intergenic
1110574107 13:77036652-77036674 CTATTGGAAGGGAGTAGAGGTGG - Intergenic
1111383708 13:87495275-87495297 CTCTGGGGATGGAATAGGGAGGG + Intergenic
1111974387 13:94950686-94950708 CAATGGGAAAGGAATAGAATGGG + Intergenic
1112582525 13:100688727-100688749 CTCTGAGTAGGGAATGCAGTAGG - Intergenic
1112920535 13:104606069-104606091 GATGGGGAAGGGAATAGAGTGGG + Intergenic
1113288325 13:108878433-108878455 AGCTGGAAAGGGGATAGAGTGGG - Intronic
1114205216 14:20564598-20564620 CTATGGGAAGGGACCAGAATGGG - Intergenic
1114315002 14:21501703-21501725 CTCTTGGAAGGGAATGAGGTGGG - Intronic
1115378433 14:32705341-32705363 CATTGGGAAGGGAAGAGAGTGGG + Intronic
1116790668 14:49336625-49336647 CTCTGGGACAAGAATAGACTAGG - Intergenic
1116890425 14:50262592-50262614 CTCTGGTGAGGGAAGAGAATGGG - Intronic
1117532564 14:56673907-56673929 CCATGGGAAGGACATAGAGTAGG + Intronic
1118360587 14:65053363-65053385 CTCTGGGGAGGGAAGGGAGAGGG + Intronic
1118461059 14:65987468-65987490 GTATGGGCAGGGGATAGAGTTGG + Intronic
1118570657 14:67191499-67191521 CATTGGGAAGGGGAGAGAGTGGG - Intronic
1119202380 14:72765976-72765998 CTCTGGGGAGGGAGTAAAGAAGG + Intronic
1119767955 14:77202361-77202383 CCCTGGGAAGCCAATACAGTGGG - Intronic
1120861340 14:89257509-89257531 CTGTGGGAAGAGACTAGATTAGG + Intronic
1121322038 14:92997475-92997497 TTCTGGGATGGGAACAGAGAGGG + Intronic
1121349492 14:93162080-93162102 CCCTGGGAAATGAATACAGTGGG + Intergenic
1122936099 14:104957026-104957048 CTCGGGGAAGGGATCAGAGGAGG - Intronic
1122983197 14:105200704-105200726 CTCTGGGGAGGGGATGGAGAAGG - Intergenic
1123181296 14:106472925-106472947 CCCAGGGAAGGGACTGGAGTGGG - Intergenic
1202945599 14_KI270726v1_random:23775-23797 CCCAGGGAAGGGACTGGAGTGGG + Intergenic
1125467436 15:39968139-39968161 CTCTTGGAAGTCAATAGAGATGG + Intronic
1125607438 15:40949137-40949159 CTCTGGTAAGAGAAGAGAGAAGG + Intergenic
1125835754 15:42749254-42749276 TTCTGGGAAGACAGTAGAGTAGG + Intronic
1126063490 15:44806589-44806611 CTCTGGGAAGGGAATGACCTTGG - Intergenic
1126451599 15:48814547-48814569 ATCTGGGAAGGGAATACGATTGG - Intergenic
1126686129 15:51250502-51250524 CACTGGGAAGACAATAGATTAGG - Intronic
1126741900 15:51785665-51785687 GCCTGGGAAGGGAAGGGAGTAGG + Intronic
1126868872 15:52966122-52966144 AGCTGGGAAGGGATTGGAGTAGG + Intergenic
1126900682 15:53311100-53311122 CTCTAGGGAGTGATTAGAGTAGG - Intergenic
1126941223 15:53767979-53768001 CTCTGGGAAAGCATTAGAGGTGG - Intergenic
1127185262 15:56472705-56472727 CTCTGGGAAGGAGATGCAGTAGG - Intergenic
1128150363 15:65359652-65359674 TTCAGGGAAGAGAATAGAATAGG + Intronic
1128934631 15:71734851-71734873 CTCTGGGAAGGGCATGGGGTTGG - Intronic
1128969001 15:72089534-72089556 CTCTGGGAAAGGAAGGGAGGAGG + Intronic
1129016865 15:72475433-72475455 CTTTTGGAAGGGATTAGAGTAGG + Intronic
1130801948 15:87273971-87273993 TTCTGGGAAGACAGTAGAGTAGG + Intergenic
1131582679 15:93660581-93660603 GTCTGGGAAGGGAAAAGGGAAGG - Intergenic
1131931605 15:97448910-97448932 AGCTGGAAAGGGGATAGAGTGGG - Intergenic
1134304220 16:13017942-13017964 CTTTGAGAAGGGAATACAGGTGG - Intronic
1135465375 16:22680304-22680326 CTCTGGGATGGGGAAAGAGAAGG + Intergenic
1137396760 16:48121488-48121510 CACTGGGAAGAGGATAGAATCGG - Intronic
1137989747 16:53142011-53142033 CTTTGGGAAAGGAATAAAATAGG + Intronic
1138222112 16:55260723-55260745 CTGTGAGAAGGGAAGACAGTAGG - Intergenic
1138959117 16:62007788-62007810 CTGAGGGAAGGAAAGAGAGTAGG - Intronic
1139216793 16:65133465-65133487 CTCTGGGAAGGGACAAGGGCAGG - Intergenic
1139893777 16:70271745-70271767 CTCAAGGAAAGGAATGGAGTAGG + Intronic
1140357054 16:74315391-74315413 CTCTGGCAATGGAGTAGAATAGG - Intergenic
1140916071 16:79494520-79494542 CTCTGGGGTGGGAATACAATCGG - Intergenic
1141769101 16:86078124-86078146 CTCTGGGAAGGGAAGGCAGAGGG - Intergenic
1142968341 17:3594854-3594876 GCCTGGGAAGGGAACAGAGGTGG + Intronic
1143187326 17:5018275-5018297 CTCTCTAAAGGGAATAGGGTTGG - Intronic
1143749769 17:9020320-9020342 CTCTGGGAAAGGAATACACTGGG - Intergenic
1144373033 17:14611150-14611172 GTCTGGGAATGGGCTAGAGTGGG + Intergenic
1144858240 17:18282795-18282817 CTTTGGGAATGGGACAGAGTTGG - Exonic
1145014592 17:19387893-19387915 CTGTGGGAGGGGAAAAGAGTGGG - Intergenic
1145256083 17:21323241-21323263 CTGCGGGAGGGGAATAGAGGTGG + Intergenic
1145320530 17:21764709-21764731 CTGTGGGAGGGGAATAGAGGTGG - Intergenic
1147262064 17:39214503-39214525 CACTGGGACGGGAATGGAGAGGG + Intronic
1147318658 17:39633111-39633133 GGCTGGGAAGGGAACAGTGTGGG - Intronic
1147978485 17:44261042-44261064 CACTGGGGAGGGAAAGGAGTGGG + Intronic
1148083153 17:44978493-44978515 CCCTGGGAAGGACCTAGAGTGGG - Intergenic
1148238654 17:45985597-45985619 CTCTGAGAAGGTCACAGAGTGGG + Intronic
1148733570 17:49851959-49851981 CTCTGGGAGGGGAAACGAGGTGG - Intergenic
1149869248 17:60168004-60168026 CTCTCTTAAGGGAATAGGGTTGG + Intronic
1150209854 17:63435963-63435985 CTCTGGGGAGGGAACAGAGCAGG + Intronic
1150931526 17:69590247-69590269 AGCTGGGAAGGGGATGGAGTGGG + Intergenic
1151164433 17:72191902-72191924 CCCTGGGATGGGAATAGGGTAGG - Intergenic
1151182754 17:72341886-72341908 CTCTGGAAAGAGACAAGAGTGGG + Intergenic
1151236657 17:72725092-72725114 TTCTGGGAAGTGAAGAAAGTGGG - Intronic
1152375415 17:79916203-79916225 CCCTGGGAAGGGAATGCTGTGGG - Intergenic
1153057481 18:960907-960929 CTTTGACAAGGGAATACAGTTGG + Intergenic
1153121379 18:1731175-1731197 ATCTGTTAAGGGAATAGGGTTGG - Intergenic
1155371280 18:25103734-25103756 CTCTGTGATGGGAAGAGAGAAGG + Intronic
1156196683 18:34782147-34782169 CTAAGTGAATGGAATAGAGTAGG - Intronic
1156432752 18:37092969-37092991 CTGTGGCAAGGGATTAGTGTTGG - Intronic
1156467472 18:37356922-37356944 CTCTGGGAGAGGAAGAGTGTAGG - Intronic
1156951908 18:42910723-42910745 CACTGGAAAGGGGATGGAGTGGG - Intronic
1157818275 18:50746893-50746915 ATCTGGGAACAGATTAGAGTGGG - Intergenic
1157935437 18:51866918-51866940 TTCAGGCAAGGGAATTGAGTTGG + Intergenic
1158630634 18:59111304-59111326 CTTTGGGTAGGGCATGGAGTGGG + Intergenic
1159054977 18:63454368-63454390 CTGTGGGAAAGGAGTAAAGTTGG - Intergenic
1159435522 18:68411938-68411960 ATCTTGGCAGGGAATAAAGTGGG + Intergenic
1159787618 18:72733034-72733056 ATCTGAGAAGGAAAGAGAGTTGG - Intergenic
1159855527 18:73583126-73583148 CTTTGGGAAGGGAGGTGAGTAGG + Intergenic
1162496269 19:11024953-11024975 CTCTGGGCTGGGAATGGACTAGG - Intronic
1163264064 19:16207750-16207772 GTCTGGGCAGGGAAGAGAATGGG + Intronic
1163787210 19:19280974-19280996 CTCTGGGAAGGGAAAAGATTTGG + Intronic
1165065058 19:33224050-33224072 ATGTGGGGAGGGGATAGAGTAGG + Intronic
1165328106 19:35125841-35125863 CTCTGGGTGGGGAACAGACTGGG - Intronic
1165374405 19:35431553-35431575 CTTTCGGAAGGAAATAGAATTGG - Intergenic
1165828479 19:38718996-38719018 CTCTGGGAAGGGATGGGAGGTGG - Intronic
1166042070 19:40209753-40209775 CTCAGGGAAGGGAATAAAAGAGG + Intronic
1166684805 19:44789981-44790003 CTGGGGGAAGGGAAGAGAGGGGG - Intronic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167730784 19:51252805-51252827 CTCTGGGAAGGGATTAGGGGTGG + Intronic
1168491657 19:56815946-56815968 CTGAAGGAAGGGAATACAGTAGG - Exonic
1168525149 19:57082704-57082726 CTGTGAGGAGGGAGTAGAGTGGG + Intergenic
925067257 2:938149-938171 CTCTGGGTAAGGGAGAGAGTGGG - Intergenic
925521918 2:4756112-4756134 CTCTGGGCAGGGGACAGGGTTGG - Intergenic
926153641 2:10438508-10438530 CTCTGGGGATGGAGTAGTGTTGG - Intergenic
926347135 2:11957671-11957693 CTGTGTGAAGGAAGTAGAGTGGG + Intergenic
926710920 2:15879961-15879983 CTCTGGGAAGGGAACTAGGTAGG + Intergenic
926869982 2:17405283-17405305 CTCTGTCAAGTGAATAGTGTAGG - Intergenic
928221769 2:29409232-29409254 CTCTAGTAAGGGAAGAGAATAGG + Intronic
928292993 2:30056325-30056347 TTGTGGGAAGGGAGTAGAGAGGG - Intergenic
928815171 2:35285204-35285226 CTCAGGGATGGGGATATAGTTGG - Intergenic
929820425 2:45269115-45269137 CTCTGAGAAGAAAATAGAGGTGG + Intergenic
929860025 2:45668920-45668942 CTCTTGGTAGGGACTAGAATGGG + Intronic
929962019 2:46504082-46504104 CTCTGGGAGGTGATTAGATTGGG + Intronic
930027229 2:47036501-47036523 CTCTGGGAAGGTAATAAAACTGG + Intronic
930411009 2:51027239-51027261 CACTTGGAAGGGAGTAGTGTTGG + Intronic
931625034 2:64249779-64249801 CTCTGGGAAGGGAAGAGGAATGG - Intergenic
933557391 2:83848165-83848187 CTCTGAGAAGAGAAGAGACTGGG - Intergenic
933856956 2:86423904-86423926 CTCTCTGAATTGAATAGAGTTGG + Intergenic
936380939 2:111985341-111985363 ACCTGGGAAAGGAAGAGAGTGGG + Intronic
936868636 2:117107486-117107508 CAATGGGAAGGGGACAGAGTTGG - Intergenic
937423950 2:121781799-121781821 CTCTGGGAAGGCCATAGGGCAGG - Intergenic
938313797 2:130312957-130312979 CTCTGGAAACGGCATAGAGTTGG + Intergenic
939285320 2:140121835-140121857 CACTGGGAAGGGGATGGAGCGGG - Intergenic
941993042 2:171575722-171575744 CTCTGGGGAGGGAAGAGAGAAGG + Intergenic
942173339 2:173308373-173308395 ATCTGGAAAGAGAATGGAGTGGG - Intergenic
942520029 2:176793919-176793941 CTCTGGGTAGGGAATAAAGAGGG - Intergenic
943085642 2:183307610-183307632 CTCTGAGAATGGAATATAGTGGG + Intergenic
943141930 2:183993482-183993504 GCCTGGGAATGGAATAGAGAGGG + Intergenic
944708179 2:202311859-202311881 CCCTTGGCAGGTAATAGAGTTGG + Intergenic
945042193 2:205751791-205751813 CCCTGGGAAGGGAAGTGAGAAGG + Intronic
945546823 2:211164943-211164965 CTCTGGGGAGGGGAGAGGGTAGG + Intergenic
946109240 2:217399491-217399513 GACTGGGAAGGGGATGGAGTGGG - Intronic
946254889 2:218435214-218435236 CTCTGGGCAGTGAATGTAGTAGG + Intronic
946475082 2:219999402-219999424 CTCTGGTAAGGGAGTAGACTAGG + Intergenic
947320495 2:228912179-228912201 CTCTGGTAAATGAATATAGTAGG + Intronic
947829790 2:233130892-233130914 CTCTGGGAAGCGGATGGGGTGGG + Intronic
948970588 2:241422584-241422606 CTCTGGCAAGGGCATAGAAATGG + Intronic
1170080095 20:12465238-12465260 CTTGGGGATGGGAATAGAGGTGG - Intergenic
1170562959 20:17572921-17572943 CTCTAGGGAGGGAAGGGAGTGGG - Intronic
1172013592 20:31860729-31860751 CACAGGGAAGGGAAGGGAGTCGG + Intronic
1172502418 20:35436841-35436863 CTCAGGCAAGGGGATAGAGGAGG - Intronic
1172845302 20:37926673-37926695 CTCTGGGAAGAGCATGGACTTGG + Intronic
1172946487 20:38693354-38693376 CGCTGCTAAGGGAATGGAGTGGG + Intergenic
1173576918 20:44118241-44118263 CTCTGAGCAGGGAAGACAGTTGG - Intronic
1174277731 20:49416003-49416025 CTCTGGGATCGGAATGGTGTGGG - Intronic
1176981011 21:15381040-15381062 AGCTGGAAAGGGAATGGAGTGGG - Intergenic
1178303704 21:31473100-31473122 TTCTGGGAAGACAACAGAGTGGG - Intronic
1178469447 21:32878974-32878996 CTGTGGGAAGGGTATAGGATGGG + Intergenic
1178639961 21:34337760-34337782 TTCTAGAAAGGGAAGAGAGTTGG - Intergenic
1178932229 21:36829740-36829762 CTCTGGGAAGGGAATAGAGTGGG - Intronic
1179987041 21:44927779-44927801 CTCGGGGCAGGAAATGGAGTTGG + Intronic
1180202726 21:46235484-46235506 CTCTGGGAAGGTACTAGATCTGG + Intronic
1181722564 22:24786990-24787012 ATCTGGTAATGGATTAGAGTCGG + Intergenic
1181904798 22:26185926-26185948 CTCTGGGGAGGGAATATGGTGGG - Intronic
1182336776 22:29588830-29588852 CTTTGGGAAGGGAAGAGGGCAGG - Intergenic
1182357218 22:29727641-29727663 CTCTGAGGAGAGAATGGAGTAGG - Exonic
1182361126 22:29747095-29747117 CTCTGGGGAGGGGATGGGGTTGG + Intronic
1182468123 22:30530833-30530855 CTCTGGGAAGGGCTGAGAGTAGG - Intronic
1182882331 22:33744427-33744449 CTCTGTGATGGGAATGGAATGGG + Intronic
1182884814 22:33764271-33764293 CTCTGGAAGGAGAATTGAGTAGG - Intronic
1183925031 22:41199650-41199672 TTCTGGGAAGGGAATTGTGGGGG + Intergenic
1184225766 22:43128154-43128176 CTCCGGTGGGGGAATAGAGTGGG + Intronic
1184685948 22:46096419-46096441 CTGTGGGATGGGAAGAGGGTCGG + Intronic
1184978273 22:48078651-48078673 CTCTGGGAAGAGAAGATACTGGG - Intergenic
952114585 3:30163406-30163428 CTCTGTGAAGAAAATAGAGGTGG + Intergenic
952257667 3:31709392-31709414 TTCTGGGGAGGGGAGAGAGTGGG + Intronic
952697586 3:36287049-36287071 GGCTGGGAAGGGTATAGAGAAGG + Intergenic
953075729 3:39568717-39568739 CTCTGGCAAGGGGATACTGTAGG + Intergenic
953407342 3:42665991-42666013 TGCTGGGAAGGCAATAGTGTCGG - Intergenic
953919894 3:46944558-46944580 ATTTGGGAAGGGTATTGAGTGGG - Intronic
954800707 3:53185583-53185605 CTCTGGGGAGGGAGCAGAGGTGG - Exonic
955588969 3:60514039-60514061 AGCTGGAAAGGGAATGGAGTGGG - Intronic
956665482 3:71638172-71638194 TTCTGGGATGGGCATAAAGTGGG + Intergenic
956840539 3:73135819-73135841 CTGTGGAAAGGGAATGTAGTGGG + Intergenic
956972250 3:74539739-74539761 CTCTAAGAAGTGGATAGAGTGGG + Intergenic
959204257 3:103284545-103284567 AACTGGAAAGGGAATAGAGTGGG + Intergenic
959676264 3:109039451-109039473 TTCTGGGAAGAAGATAGAGTAGG + Intronic
961352221 3:126311300-126311322 GTTTGGGAAGAGAATAGAGGAGG - Intergenic
964904288 3:161699545-161699567 CTCTGAAAAGGGGATAGATTGGG + Intergenic
965033684 3:163406503-163406525 CTCAAGGAAGGGACCAGAGTTGG + Intergenic
965505293 3:169508316-169508338 ATCTGGCATGGGAATAGGGTGGG + Intronic
966885694 3:184377046-184377068 ATCTGGGATGGGGATAGAGAAGG + Intronic
967140795 3:186557538-186557560 CTCTGGGAAGGACACAAAGTTGG + Intronic
968129517 3:196184756-196184778 CTCTGGGCGGGGAATGGGGTGGG + Intergenic
969487173 4:7478771-7478793 CACTGGGAAGGGGACAGAGTGGG + Intronic
969969961 4:11036546-11036568 CTCTGGGAAGGATAGAGTGTGGG - Intergenic
970450338 4:16160167-16160189 CTGTGGGAAGGGGACAGAGGAGG + Intergenic
971355957 4:25895590-25895612 CTCTGGGAAATGAATAGAGGTGG + Intronic
972288828 4:37672167-37672189 CTCTGGGAAGGGAAAGGGGCTGG - Intronic
972775563 4:42236728-42236750 CCCTGGGAGGGGAAGGGAGTGGG + Intergenic
974186526 4:58454467-58454489 AGCTGGGAGGGGAATGGAGTGGG + Intergenic
974565713 4:63576731-63576753 CTCTGGTAAGGGAAGAAGGTGGG + Intergenic
975415836 4:74103303-74103325 CTCTGGGAAGCCAAGACAGTAGG + Intergenic
975612025 4:76213221-76213243 CACTGTAAAGGGAACAGAGTCGG + Intronic
976110064 4:81663161-81663183 GTCTGGGAAGGCAATACTGTAGG - Intronic
978458051 4:108917344-108917366 CTCTGGGAAGGCAAGATAATGGG + Intronic
979396166 4:120192043-120192065 CTCTGAGAAGAGGTTAGAGTGGG - Intergenic
979551404 4:121995265-121995287 TTCTGGGAAGGAAATAGGATGGG + Intergenic
980244780 4:130224620-130224642 CAGTGGGAAGGGAACAGTGTTGG + Intergenic
980496556 4:133592378-133592400 AGCTGGGAAGGGGATGGAGTGGG - Intergenic
980528787 4:134023390-134023412 CTCTGGGAAGATGATGGAGTAGG - Intergenic
980750324 4:137078735-137078757 CTCTGGGAAGAGAGGGGAGTAGG - Intergenic
982159133 4:152550008-152550030 CCCTGGGAAGCTAATACAGTAGG - Intergenic
982382104 4:154760273-154760295 CTTTGGGAGGTGATTAGAGTTGG + Intergenic
982452320 4:155568122-155568144 CTCTGTGAAGGGAGTTGAGTAGG - Intergenic
982487502 4:155984609-155984631 CCCAGGCATGGGAATAGAGTGGG + Intergenic
982522309 4:156433589-156433611 CTGTGGGAATGGATTAGAATTGG + Intergenic
982831828 4:160071831-160071853 CTGTGAGAAGTGAATATAGTTGG + Intergenic
985376181 4:189341394-189341416 CTCTGAAAAGGGAGAAGAGTGGG + Intergenic
986041903 5:4001706-4001728 GTCTTGGAAGGGAATGGAGCTGG - Intergenic
986727017 5:10606087-10606109 CTCTGAGATAGGAATAGATTAGG + Intronic
986969767 5:13318761-13318783 CTCAGGGAAGGGAATATATAAGG - Intergenic
987231456 5:15897864-15897886 CAATGGGAATGGACTAGAGTTGG + Intronic
988008647 5:25453588-25453610 CTTGGAGAAGGGAGTAGAGTGGG + Intergenic
988632700 5:32947794-32947816 CTCTGGTAATGGAATGGAGTTGG - Intergenic
988776517 5:34482297-34482319 AGCTGGGAAGGGGATGGAGTGGG - Intergenic
989102521 5:37835741-37835763 CTCTGGGAGGGGAAGGGATTAGG - Exonic
991399256 5:66236261-66236283 CTCTGGGAGGGGAGAAGAGTTGG + Intergenic
991644998 5:68792670-68792692 ATCTGGAAAGGGGATGGAGTGGG + Intergenic
992723572 5:79584186-79584208 CTCTGGAGATGGAATAGAATTGG + Intergenic
993378321 5:87176288-87176310 CTCTCAGAAGAGAATGGAGTCGG - Intergenic
994140536 5:96336020-96336042 CTCTGGAGAGAGAATGGAGTGGG - Intergenic
994533210 5:100992893-100992915 AGCTGGAAAGGGAATGGAGTGGG + Intergenic
994890207 5:105623606-105623628 CTCTGGGAAAGGAACAGAGAGGG + Intergenic
996242062 5:121215909-121215931 AGCTGGGAAGAGAATGGAGTGGG - Intergenic
997675439 5:135709250-135709272 CTCTGGGAAGGAACTGGAATTGG + Intergenic
997787062 5:136723112-136723134 CCCTGGGAAGGGATCAGACTTGG - Intergenic
998354926 5:141527066-141527088 CTCTGGGGAGGGGAAAGAGAGGG + Intronic
998371058 5:141661788-141661810 CTCTGGGGATGGAATGGAGGAGG + Exonic
998742721 5:145223209-145223231 TTATTGGAAGGGAAAAGAGTAGG + Intergenic
999096220 5:148980193-148980215 CTCTGGGAATGGAATAGAAAAGG - Intronic
999801344 5:155040611-155040633 CTCTGGGAGGAGAAAAGAGCTGG + Intergenic
999845517 5:155475307-155475329 CTGTGGGAAGGGTGTGGAGTTGG - Intergenic
1000580613 5:163031355-163031377 CTCTGGGGAGGGATTAGGGGTGG + Intergenic
1001170298 5:169413173-169413195 CACTGGGATGGGTAGAGAGTTGG + Intergenic
1001712054 5:173786874-173786896 TTCTGGGAAGGGAGTATGGTTGG - Intergenic
1002077380 5:176716871-176716893 CTCTGAGATGTGAATAGACTTGG + Intergenic
1002586184 5:180250118-180250140 CACTGGGGAGGGAAGAGAGGTGG - Intronic
1002854755 6:1026956-1026978 CTCTGGCAAGGTGATAGCGTTGG + Intergenic
1005178564 6:23076496-23076518 TTCTGGGAAGGGAAGAGGGTGGG + Intergenic
1005613001 6:27544818-27544840 TTCTGGGAATGGAAGTGAGTCGG - Intergenic
1005946833 6:30601773-30601795 TTGGGGGAAGGGCATAGAGTAGG + Intronic
1006536730 6:34705155-34705177 CTCTGGGAAGTGAATAGGTGAGG + Intergenic
1006679686 6:35788045-35788067 CTCTGGGTAGGGAGGAGAGCAGG - Exonic
1006712291 6:36084313-36084335 CTCTGGCAAGGGCATAGATGTGG + Intronic
1007001317 6:38316262-38316284 CTCTCCAAAGGGCATAGAGTGGG - Intronic
1007506091 6:42336607-42336629 TTCTGTGAAGGGCTTAGAGTGGG - Intronic
1007626460 6:43249171-43249193 CTCTGTGAAATGAATAGAGTTGG - Intronic
1007718588 6:43871709-43871731 CTCTGGAAAGGCAATATGGTAGG - Intergenic
1008043665 6:46829691-46829713 CTCTGAGAAGAGAAGAAAGTGGG - Intronic
1008193314 6:48486882-48486904 CTGTGGGATGGGACTAGAGTGGG - Intergenic
1009369872 6:62885731-62885753 CTCTGGGTAGGAAATGGAGAAGG + Intergenic
1010721903 6:79292274-79292296 CTCAGGGAAGGCAATATTGTTGG + Intergenic
1010746946 6:79574276-79574298 CTGTGGGAAGGGAATATATGGGG + Intergenic
1012146978 6:95696754-95696776 CTCTGGGAAATGTATAGAGAAGG - Intergenic
1014430391 6:121363681-121363703 ATGTGGTAATGGAATAGAGTTGG + Intergenic
1014818426 6:125959325-125959347 ACCTGGAAAGGGAATAGAGAAGG + Intronic
1015522474 6:134145610-134145632 CTCTTGGAAGTGAATAGATTAGG + Intergenic
1015839888 6:137465944-137465966 AGCTGGAAAGCGAATAGAGTGGG + Intergenic
1016531714 6:145065682-145065704 CTCTGTGCAGGGAAAAGAGGAGG + Intergenic
1017472155 6:154749663-154749685 CTTTGGGTAGGGGATAGGGTAGG + Intronic
1018906541 6:168079197-168079219 CACTGGGAAGGGAATTGAGAGGG + Intronic
1019301940 7:309792-309814 CGCTGGGCAGGGAAGAGGGTGGG + Intergenic
1020584238 7:10046110-10046132 ATCTGGTTATGGAATAGAGTTGG - Intergenic
1023467077 7:40468008-40468030 CTCTTGAAAGGGAATAGAATAGG - Intronic
1023549279 7:41351888-41351910 CTCTGGGAAATGAATAAAATAGG + Intergenic
1023712928 7:43013914-43013936 ATCTGGGAATGGTATAGGGTGGG + Intergenic
1024528684 7:50372334-50372356 TGGTGGGAAGGGAACAGAGTGGG - Intronic
1024787121 7:52921240-52921262 TTCTGGGAGGGGAAAGGAGTAGG + Intergenic
1026444497 7:70472210-70472232 CTCAGGAAAGGGAGTACAGTGGG - Intronic
1027224323 7:76234487-76234509 CTCTGGGGTGGGAATAGAGTAGG + Intronic
1028476473 7:91258689-91258711 CCCTGGGAAAGAAATAGAGATGG - Intergenic
1030478743 7:110074794-110074816 CAATGGGAAGGAAATAAAGTAGG - Intergenic
1032558619 7:132864285-132864307 CTCAGGGGAGGGAAAAGAGATGG + Intronic
1034076754 7:148239398-148239420 CTATGGGAAGAGAAGAGAGAGGG + Intronic
1034345226 7:150381788-150381810 ATCTGGGGAGGGAACAGAGGAGG - Intronic
1037745915 8:21643966-21643988 CTGTGGCCAGGGAATAAAGTGGG + Intergenic
1037774356 8:21823144-21823166 CTCTAGGAAGGGAAGTGAGTGGG - Intergenic
1037897807 8:22669824-22669846 CTCTGGGAAGGAACAAGAGCAGG - Intergenic
1037988128 8:23302320-23302342 ATGTGGGTAGGGAATTGAGTGGG - Intronic
1038254054 8:25934489-25934511 CATTTGGAAGGGAAGAGAGTTGG + Intronic
1038746672 8:30260884-30260906 CCTTGGGAAGGGAACAGACTTGG + Intergenic
1041201981 8:55458630-55458652 AGCTGGAAAGGGAATGGAGTGGG + Intronic
1042605930 8:70546580-70546602 CTTTGGGAAGGAAACAGAATGGG + Intergenic
1043485502 8:80695262-80695284 CTCTGGGAAGGGCAGACAGTTGG - Intronic
1044830132 8:96239259-96239281 CTCAGAGAAGGGGAAAGAGTTGG - Intergenic
1045061533 8:98415513-98415535 CTCTTAGGAGGGAATAGAGATGG - Intronic
1047373104 8:124272467-124272489 CTCTGGGAATGGAAGGGATTAGG + Intergenic
1048350512 8:133612049-133612071 CTCTGGGAATGGGATGGAGTAGG + Intergenic
1048791357 8:138107008-138107030 CTCTGGGGTGGGAATGGTGTGGG + Intergenic
1049210737 8:141385342-141385364 TTCTGGGAAGGGACAAGAGACGG - Intergenic
1055320521 9:75079731-75079753 CTTGGGGAAGGGAATAGGATGGG + Intronic
1055486279 9:76759599-76759621 AGCTGGAAAGGGAATGGAGTGGG - Intronic
1057299217 9:93867259-93867281 GACTGGGGAGGGAAGAGAGTGGG - Intergenic
1058256905 9:102777940-102777962 AGCTGGGAAGGGGATAGAGTGGG - Intergenic
1059382998 9:113943064-113943086 CACTGGGAAGGAGATAGGGTAGG + Intronic
1059511292 9:114850559-114850581 CTTTGGGAAAGGAATGGAGTAGG + Intergenic
1059706097 9:116824973-116824995 CTCTAGGAAGGGAATCCTGTAGG + Intronic
1060534924 9:124377798-124377820 CTCTCTGAAGGGTATAGGGTAGG + Intronic
1061491843 9:130949254-130949276 CTCCAGGAAGGGCATGGAGTGGG + Intergenic
1061676863 9:132222339-132222361 CTCTGGGAAAGGCACAGAGGGGG - Intronic
1062383453 9:136298719-136298741 CTCTGGGGACCGCATAGAGTGGG - Intronic
1185738504 X:2511782-2511804 AGCTGGAAAGGGAATGGAGTGGG + Intergenic
1185943574 X:4348781-4348803 GGCTGGGAAGGGAAAAGAGAAGG - Intergenic
1187265153 X:17725628-17725650 CCCCGGGAAGGTAATAGAGGTGG + Exonic
1188002442 X:24995103-24995125 CTCTGGGAAGGGAAAGGAGAGGG + Intronic
1191725196 X:64271887-64271909 CCCTGGGAAGGGAAAAGAGTTGG + Intronic
1192057529 X:67787469-67787491 CTATGGGAAAGGAATGGAATGGG + Intergenic
1192436649 X:71147492-71147514 GTCTGGGAGGGCAACAGAGTTGG - Intronic
1192576518 X:72247274-72247296 ATCTGGGAAGGGACTAGAAGAGG - Intronic
1195461616 X:105132612-105132634 TTTTGGAAAGGAAATAGAGTGGG - Intronic
1196861562 X:120033658-120033680 AGCTGGAAAGGGAATGGAGTGGG - Intergenic
1197343509 X:125303409-125303431 CTCTAGGGAGGGAGTAGGGTTGG - Intergenic
1197374720 X:125668262-125668284 CTGTGGAAAGAGAATAAAGTTGG + Intergenic
1197666925 X:129234136-129234158 CTCTGGGAATGCAAGGGAGTGGG + Intergenic
1199275001 X:145930582-145930604 GTCTGGGAAGGGAAGGGAGCGGG - Intergenic
1199378258 X:147137738-147137760 CTGGGGGAAGGGAATGGAATAGG + Intergenic
1199977758 X:152904390-152904412 CTCTGGGAAGGGGATGGAGCAGG - Intergenic
1200418431 Y:2936224-2936246 CTCTCGGAAGGGCACAGAGCCGG - Intronic
1201018396 Y:9626659-9626681 CTCAGGGCAGGGAAAAGAGCGGG - Intergenic