ID: 1178934234

View in Genome Browser
Species Human (GRCh38)
Location 21:36847461-36847483
Sequence TAGGATAGTAAATAAGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 135}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178934234_1178934239 30 Left 1178934234 21:36847461-36847483 CCAGCAACTTATTTACTATCCTA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1178934239 21:36847514-36847536 AGGTAAGTAATGGATATCTAAGG 0: 1
1: 0
2: 0
3: 16
4: 156
1178934234_1178934237 10 Left 1178934234 21:36847461-36847483 CCAGCAACTTATTTACTATCCTA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1178934237 21:36847494-36847516 AGTTTGCTGGATTTTATATAAGG 0: 1
1: 0
2: 3
3: 28
4: 254
1178934234_1178934236 -3 Left 1178934234 21:36847461-36847483 CCAGCAACTTATTTACTATCCTA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1178934236 21:36847481-36847503 CTACGTTAGAGTCAGTTTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 125
1178934234_1178934238 20 Left 1178934234 21:36847461-36847483 CCAGCAACTTATTTACTATCCTA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1178934238 21:36847504-36847526 ATTTTATATAAGGTAAGTAATGG 0: 1
1: 0
2: 3
3: 49
4: 445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178934234 Original CRISPR TAGGATAGTAAATAAGTTGC TGG (reversed) Intronic
900723571 1:4198500-4198522 TATGATAGTGAATAAGTCTCAGG - Intergenic
901408446 1:9066124-9066146 TAGGATACTCAACTAGTTGCTGG + Intronic
905019575 1:34799352-34799374 GAGGAAAGTAAACAAATTGCAGG - Intronic
907516101 1:54994403-54994425 TAGGTGAGTTAATGAGTTGCTGG + Intergenic
908010786 1:59775389-59775411 TAGGAGATTAAATAAGTAGTAGG - Intergenic
910167063 1:84338769-84338791 CAGGATAGTGAATAAGTCTCAGG - Intronic
913509652 1:119550078-119550100 TTGGATAGTAAATAAGGAGCTGG - Intergenic
913520471 1:119640774-119640796 TATGAGACTAAAGAAGTTGCTGG + Intronic
915232957 1:154459316-154459338 TAGGCTAGAAAATAAATTCCTGG - Intronic
917370339 1:174286309-174286331 TAGAATAATAAATAAATTCCTGG - Intronic
918669212 1:187193169-187193191 TAGGATAGTAAATACTGTGTAGG - Intergenic
919600418 1:199615701-199615723 TAGGATAGTAAATAGTGTTCAGG - Intergenic
921538025 1:216376380-216376402 GAGGGTAGTGAATAAGTTGTGGG + Intronic
923859600 1:237879943-237879965 GAGGATAGTGAATAAGTTTGGGG + Intronic
924938126 1:248789606-248789628 TAGAATCGCAAATAGGTTGCAGG - Intergenic
1063883648 10:10555450-10555472 TAGGGCAGTAAATAAGATACTGG + Intergenic
1065833075 10:29632191-29632213 TAGAATATTAAATAACTCGCCGG + Intronic
1068791184 10:61033119-61033141 TAAAATAGTAAATAACTTGAAGG - Intergenic
1069178441 10:65325273-65325295 TTGGTTAGTTTATAAGTTGCTGG + Intergenic
1070662262 10:78315586-78315608 TCAGAAAGTAAAAAAGTTGCAGG - Intergenic
1073554916 10:104440116-104440138 TAAAATAGTAAATCAGTGGCCGG - Intronic
1074664978 10:115711760-115711782 TAAGATAAGAAATAAGTTGGCGG - Intronic
1075893275 10:125972687-125972709 TATGAAAGTAAAGAAGATGCAGG + Intronic
1076302885 10:129441370-129441392 CAGGTGAGTAAATAAGATGCTGG + Intergenic
1087977955 11:104573779-104573801 AAGGATAGGAAATATGTTGGAGG + Intergenic
1090348531 11:126090948-126090970 TATAATAGTACATAACTTGCAGG - Intergenic
1095722344 12:45414229-45414251 TAGGATTATGAAAAAGTTGCAGG + Intronic
1096085286 12:48861520-48861542 TAGCATAGTATAGAAGATGCTGG - Intronic
1096970049 12:55658277-55658299 CAGGAGAGTCAAGAAGTTGCAGG - Intergenic
1097937706 12:65272143-65272165 TATGGTAGGAAAAAAGTTGCCGG - Intergenic
1099157236 12:79193380-79193402 TAGGATAGTAAATAATTAAGTGG + Intronic
1106619038 13:31356210-31356232 TGGGATAGTGAATAAGTGTCAGG + Intergenic
1106775365 13:33003524-33003546 TGGAATAGTAAATAAATTTCAGG + Intergenic
1108528228 13:51303872-51303894 TTAGATAGTAAATAACTGGCTGG + Intergenic
1109392830 13:61715307-61715329 TAGGAAAGTGACTAATTTGCAGG - Intergenic
1111074418 13:83214886-83214908 TGTGATAGTGAATAAGTTTCAGG - Intergenic
1112122958 13:96433457-96433479 TATGGTAGTGAATAAGTTTCAGG + Intronic
1118125128 14:62893457-62893479 TAGAATAGTACATAAATGGCCGG + Intronic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1121851129 14:97221981-97222003 TAGGATGGCAAATAAGGTCCAGG - Intergenic
1122738211 14:103855793-103855815 CAGGTTAGAAAATAAGTTGGTGG + Intergenic
1123736831 15:23193099-23193121 AAAAATAGTAAATAGGTTGCAGG - Intergenic
1124295174 15:28495549-28495571 AAAAATAGTAAATAGGTTGCAGG + Intergenic
1125343541 15:38697121-38697143 TAAGATAGTAAATAAATGCCTGG + Intronic
1127040606 15:54972045-54972067 AAGGATATTCAATAAGTTTCTGG + Intergenic
1129305165 15:74655476-74655498 CAGCATACTAAATAAGTGGCAGG + Intronic
1130324307 15:82866683-82866705 TATGATAGTGAATAAGTCTCAGG + Intronic
1132183146 15:99777561-99777583 TGTGATAGTAAATAAGTCTCAGG + Intergenic
1136734707 16:32455184-32455206 TAGGAAAGTAAAAAATTAGCCGG + Intergenic
1138793686 16:59941230-59941252 TAGAATAGTGAATAATTTGTAGG + Intergenic
1139203914 16:65006831-65006853 CATGATAGTAAATAAGTCTCAGG + Intronic
1139611576 16:68062743-68062765 TCATATAGTAAATAAGTGGCAGG + Intronic
1203018374 16_KI270728v1_random:374412-374434 TAGGAAAGTAAAAAAATAGCCGG - Intergenic
1203036709 16_KI270728v1_random:647570-647592 TAGGAAAGTAAAAAAATAGCCGG - Intergenic
1148965103 17:51428290-51428312 TATAATAGTAAGTAATTTGCTGG - Intergenic
1150710012 17:67523051-67523073 TAGGATGGTAAAAAAGCTTCTGG - Intronic
1151089021 17:71413986-71414008 TAGGATAATACTTATGTTGCAGG + Intergenic
1156926528 18:42586944-42586966 TAAGATAGTAAACAACTTGAGGG + Intergenic
1158453147 18:57584783-57584805 TAGGATAATAAAAGAGTTGTAGG - Intronic
1164103374 19:22079590-22079612 TGTGATAGTGAATAAGTTCCAGG - Intronic
926954482 2:18279744-18279766 TTGGATAGTGAATAAGTCTCAGG - Intronic
927290495 2:21400392-21400414 TCACATAGTAAATAAGTGGCAGG - Intergenic
927409740 2:22810911-22810933 TAGTACAGTAAATAATTTGTTGG + Intergenic
929620881 2:43352873-43352895 TAGGATAGGAAATCAGATGTAGG - Intronic
930472182 2:51830901-51830923 TTGGATAGTAAATAATTTAAAGG + Intergenic
930565964 2:53020923-53020945 CAGAATTGTAAATAAGATGCTGG - Intergenic
931689331 2:64822016-64822038 AAGGATAGTAAATAATTTTTAGG - Intergenic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
936084002 2:109454042-109454064 TACGATAGTATTTAAGTTACAGG - Intronic
936790444 2:116144815-116144837 TTGGATAGAAAATTAGTTACTGG + Intergenic
939900027 2:147840845-147840867 TAGGATACTAAATACTCTGCAGG - Intergenic
940028124 2:149230152-149230174 CATGATAGTGAATAAGTTTCAGG - Intergenic
946861814 2:224007163-224007185 TAGCATAATAAGTAAGTTGTAGG + Intronic
1177708505 21:24740059-24740081 TAGGATAGTGAATAAGGCCCAGG - Intergenic
1177763448 21:25429626-25429648 TAGGATAGTACATATGTATCTGG - Intergenic
1178934234 21:36847461-36847483 TAGGATAGTAAATAAGTTGCTGG - Intronic
950396413 3:12737397-12737419 TAGGATGGTAAATACCTTCCAGG - Intronic
955053051 3:55430958-55430980 TAGGATATGAAACAAGTTCCTGG + Intergenic
955658522 3:61270868-61270890 TATAAAAGAAAATAAGTTGCAGG - Intergenic
957883676 3:86255095-86255117 TAGGAAAGTAAAAAAGTTCCAGG + Intergenic
959308665 3:104701591-104701613 TGGGATAGGAAAAAAGGTGCAGG + Intergenic
960507876 3:118515178-118515200 TAAAATATTAAATAATTTGCTGG + Intergenic
965149851 3:164958274-164958296 TAGTATAGAAGAGAAGTTGCTGG - Intergenic
965157732 3:165086377-165086399 TTGGATAGGAACTAGGTTGCTGG + Intergenic
966659122 3:182394460-182394482 TAGGATGATAAATTAGTTACAGG + Intergenic
973042360 4:45486320-45486342 AAGTAAAGCAAATAAGTTGCTGG - Intergenic
975839186 4:78455873-78455895 TAGGATAGAAGCTAAGCTGCTGG + Intronic
976544379 4:86317733-86317755 TAGTATAGCAAATAATTTCCAGG - Intronic
977248910 4:94666533-94666555 TAGAATACAAAATAAGTTGATGG + Exonic
977311306 4:95391022-95391044 TAGGATAGTGAATAAGTCTCAGG + Intronic
977912634 4:102555706-102555728 GAGAATAGTAAATAATTTGCTGG + Intronic
978265962 4:106824249-106824271 TCTGATAGTAAATTAGTTACTGG + Intergenic
980846610 4:138332542-138332564 TCTGATAGTAAATAAGTCTCAGG - Intergenic
980873018 4:138631819-138631841 TTGGATAGTAAATCTGTTGAGGG + Intergenic
981311345 4:143300845-143300867 TAGTATAGTAGATAAGTTCAGGG + Intergenic
982929616 4:161386983-161387005 TAGGATAACAAATAAAATGCAGG - Intronic
986908165 5:12520328-12520350 CATGATAGTGAATAAGTTTCAGG - Intergenic
988908979 5:35820712-35820734 TAGGACAGCAACTAAGTGGCTGG - Intergenic
989496453 5:42115203-42115225 TAAGATATTAAAACAGTTGCAGG + Intergenic
992522989 5:77575568-77575590 TAGCACACCAAATAAGTTGCAGG + Intronic
992874285 5:81037396-81037418 TAGGATAGCATTGAAGTTGCCGG - Intronic
993117046 5:83732179-83732201 TAGAATTAAAAATAAGTTGCCGG + Intergenic
993454995 5:88117637-88117659 TAGGATTGTAAATTTGTTGAGGG - Intergenic
994735542 5:103550023-103550045 TCGGATATTAAATAAGTCCCAGG - Exonic
998601626 5:143591088-143591110 TACGATAGTGAATAAGTCTCAGG - Intergenic
1001312010 5:170617901-170617923 TGAGAGAGTAAATAAGATGCAGG + Intronic
1004835634 6:19528341-19528363 TAAGTAAGTAAATAAGTTACAGG + Intergenic
1008009322 6:46446505-46446527 TAGGAAAGTATAAAATTTGCTGG + Intronic
1010649551 6:78435941-78435963 TATGAGAGAAAATAAGTTTCAGG + Intergenic
1012110386 6:95223386-95223408 AAGGAAAGTAAATAATTTCCAGG - Intergenic
1014491455 6:122067104-122067126 TAAGATAGGAGATGAGTTGCAGG + Intergenic
1014732068 6:125043984-125044006 TAAGGTAGTTAAGAAGTTGCAGG - Intronic
1015428031 6:133095128-133095150 GAGGAGAGTTAATCAGTTGCAGG - Intergenic
1015606797 6:134965410-134965432 TAGGAAAGGAAGAAAGTTGCAGG - Intronic
1018774855 6:167004836-167004858 TAGGATAGTTAATAAATTTTTGG + Intronic
1020907259 7:14078906-14078928 TAGAATAGTTAATAACATGCTGG + Intergenic
1023797160 7:43803371-43803393 CAGGATAATAAAAAAGTTTCAGG - Intronic
1024180967 7:46894507-46894529 CAGGGTAGTAAATAAGTCTCAGG + Intergenic
1025816080 7:64913131-64913153 AAGAATAGAAAATAAGTTGCTGG - Intronic
1030564519 7:111136471-111136493 TAGCATAATCAATAACTTGCAGG - Intronic
1032065408 7:128765849-128765871 TACATTAGTAAATAAGTTGATGG + Intronic
1032961084 7:137035463-137035485 TTGGATAGTAAATACGTGGTTGG - Intergenic
1033542083 7:142366513-142366535 CATGATAGTAAATAAGTCTCAGG - Intergenic
1038605867 8:29003648-29003670 TAGGATAGGAAATAAGGGGTGGG + Intronic
1041084249 8:54242521-54242543 CATGATAATTAATAAGTTGCTGG + Intergenic
1043669885 8:82870472-82870494 AATGATAATAAATAAGTTACTGG + Intergenic
1045214023 8:100129357-100129379 CAGGATAGTGAATAAGTCTCAGG - Intronic
1045503327 8:102759766-102759788 TAGAGTAATAAATAAGTTGGAGG - Intergenic
1045628003 8:104079218-104079240 GAGAATTGTAGATAAGTTGCAGG + Intronic
1046218915 8:111187112-111187134 TAAGATAGTATATAAGTTGAAGG - Intergenic
1046736644 8:117783180-117783202 TAGGATAATCATTAAATTGCTGG + Intergenic
1047430689 8:124789193-124789215 TGGGATAGTGAATAAGTCTCAGG - Intergenic
1048575832 8:135689373-135689395 TAGAATAGAAAATAACTTGGAGG + Intergenic
1058123733 9:101168016-101168038 TATGATAGTGAATAAGTCTCAGG - Intronic
1059472773 9:114519065-114519087 TAGGTTAGAAAATAAGTTGATGG + Intergenic
1059943151 9:119377581-119377603 TTATATAGAAAATAAGTTGCTGG - Intergenic
1060445361 9:123682126-123682148 TAGGATAGCAAAGTAGATGCTGG - Intronic
1186371320 X:8950272-8950294 TAGGATAATGAACAAGTTGTGGG - Intergenic
1186831638 X:13396322-13396344 TGGGATAGTGAATAAGTTTCAGG - Intergenic
1188785222 X:34337214-34337236 TATGATAGTGAATAAGTCTCAGG - Intergenic
1190451542 X:50586409-50586431 TCAGATAGAAAATAAGTAGCTGG + Intergenic
1194598319 X:95887794-95887816 TAGGATTTTAGATAAGTTTCTGG - Intergenic
1196558403 X:117119016-117119038 TTGGATTATAAATAAGTTGAAGG + Intergenic
1197376611 X:125689621-125689643 CATGATAGTGAATAAGTAGCAGG + Intergenic
1201452386 Y:14130056-14130078 CATGATAGTGAATAAGTTTCAGG + Intergenic