ID: 1178936854

View in Genome Browser
Species Human (GRCh38)
Location 21:36870257-36870279
Sequence GTGGTGTCAATGAGGTTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 121}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178936854_1178936863 2 Left 1178936854 21:36870257-36870279 CCCGGGAACCTCATTGACACCAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1178936863 21:36870282-36870304 GCTTATTACCATGAAGGGGTGGG 0: 1
1: 0
2: 1
3: 6
4: 83
1178936854_1178936859 -4 Left 1178936854 21:36870257-36870279 CCCGGGAACCTCATTGACACCAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1178936859 21:36870276-36870298 CCACAGGCTTATTACCATGAAGG 0: 1
1: 0
2: 0
3: 12
4: 88
1178936854_1178936860 -3 Left 1178936854 21:36870257-36870279 CCCGGGAACCTCATTGACACCAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1178936860 21:36870277-36870299 CACAGGCTTATTACCATGAAGGG 0: 1
1: 0
2: 0
3: 9
4: 127
1178936854_1178936865 4 Left 1178936854 21:36870257-36870279 CCCGGGAACCTCATTGACACCAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1178936865 21:36870284-36870306 TTATTACCATGAAGGGGTGGGGG 0: 1
1: 0
2: 0
3: 50
4: 480
1178936854_1178936867 8 Left 1178936854 21:36870257-36870279 CCCGGGAACCTCATTGACACCAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1178936867 21:36870288-36870310 TACCATGAAGGGGTGGGGGGAGG 0: 1
1: 0
2: 1
3: 54
4: 527
1178936854_1178936861 -2 Left 1178936854 21:36870257-36870279 CCCGGGAACCTCATTGACACCAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1178936861 21:36870278-36870300 ACAGGCTTATTACCATGAAGGGG 0: 1
1: 0
2: 0
3: 9
4: 121
1178936854_1178936862 1 Left 1178936854 21:36870257-36870279 CCCGGGAACCTCATTGACACCAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1178936862 21:36870281-36870303 GGCTTATTACCATGAAGGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 87
1178936854_1178936864 3 Left 1178936854 21:36870257-36870279 CCCGGGAACCTCATTGACACCAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1178936864 21:36870283-36870305 CTTATTACCATGAAGGGGTGGGG 0: 1
1: 0
2: 0
3: 31
4: 198
1178936854_1178936866 5 Left 1178936854 21:36870257-36870279 CCCGGGAACCTCATTGACACCAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1178936866 21:36870285-36870307 TATTACCATGAAGGGGTGGGGGG 0: 1
1: 0
2: 2
3: 7
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178936854 Original CRISPR GTGGTGTCAATGAGGTTCCC GGG (reversed) Intronic
900324444 1:2101367-2101389 GTGGTCTCACTGATGTCCCCCGG + Intronic
906579762 1:46927022-46927044 ATCCTGTCCATGAGGTTCCCAGG + Intergenic
910026060 1:82654925-82654947 CTGGTGTCAATCAGATGCCCAGG + Intergenic
912100012 1:106192700-106192722 TTGGAGTGTATGAGGTTCCCAGG + Intergenic
918616832 1:186553686-186553708 GTGGTGGTAATGAGGATCACTGG + Intergenic
922418689 1:225444748-225444770 GTGGTAGAACTGAGGTTCCCAGG - Intergenic
922653801 1:227363611-227363633 GGGGTCTCAACGAGATTCCCTGG + Intergenic
924066662 1:240230122-240230144 GTGGTCTCATTGTGTTTCCCAGG - Intronic
1064247341 10:13679581-13679603 GTGGGGTCAAGGAGGTTCTGTGG + Intronic
1064290805 10:14032579-14032601 GTGGTGGCAACGTAGTTCCCAGG - Intronic
1065955009 10:30685729-30685751 GGGGTGTCACTGTGTTTCCCAGG + Intergenic
1067433812 10:46263777-46263799 CTGGTGTCACTGAGGGTCCAGGG + Intergenic
1068258164 10:54541239-54541261 GTGATGTCATCGAGGTTTCCTGG - Intronic
1072926561 10:99621282-99621304 GTTGAATGAATGAGGTTCCCCGG + Intergenic
1073900468 10:108215107-108215129 GGGATGAGAATGAGGTTCCCAGG + Intergenic
1074518163 10:114190956-114190978 GTGGTGACACTGAGTTTCCTGGG - Exonic
1075404978 10:122188753-122188775 GTGATGTTACTGGGGTTCCCGGG - Intronic
1075654269 10:124151058-124151080 CTGCTGTCATTGTGGTTCCCAGG - Intergenic
1077482833 11:2824596-2824618 GGGGTGTGGATGAGGTTGCCTGG + Intronic
1080787863 11:35492379-35492401 GTGGTCTCAACGAGTATCCCAGG + Intronic
1083565287 11:63710220-63710242 GTGGTCTCACTGTGTTTCCCAGG + Intronic
1085044990 11:73347474-73347496 GTGGGGTCAGGGAGGTTTCCTGG + Intronic
1089415324 11:118284491-118284513 GGGGTGTCACTGTGTTTCCCAGG - Intergenic
1089502786 11:118942050-118942072 GGGGTGTCAATGTGCTTCCCAGG - Intronic
1089748990 11:120636941-120636963 GAGGTGTCTATGAGTTTCCCAGG + Intronic
1099393046 12:82103238-82103260 GGGATGACAGTGAGGTTCCCAGG - Intergenic
1099687452 12:85908104-85908126 GGGATGGGAATGAGGTTCCCAGG + Intergenic
1113781485 13:112980063-112980085 GTGGGTTTAATGAGGCTCCCCGG + Intronic
1115776059 14:36716584-36716606 TTGGTGTAAATGAAGCTCCCAGG + Intronic
1118803431 14:69212540-69212562 GTGGTGTCACTCTGTTTCCCAGG + Intronic
1122211478 14:100176872-100176894 GTGGTGGCAATGGGGTGCCCTGG - Intergenic
1123968914 15:25486252-25486274 GTGGGGACAAAGAGGTTTCCTGG + Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1133338948 16:5024386-5024408 GGGGTGTCACTGAGTTGCCCAGG - Intergenic
1133718629 16:8473267-8473289 GTGGTCTCACTGTGTTTCCCAGG - Intergenic
1136869280 16:33790482-33790504 GTGGTGGCAATTAGGTGCCTCGG - Intergenic
1137619790 16:49868633-49868655 GTGAGGTCCATGGGGTTCCCAGG - Intergenic
1139183846 16:64779746-64779768 GTGGTCACAATGAGTTTCCAAGG + Intergenic
1140021911 16:71247025-71247047 GTGGTCTCACTGTGTTTCCCGGG + Intergenic
1203102893 16_KI270728v1_random:1325586-1325608 GTGGTGGCAATTAGGTGCCTCGG + Intergenic
1148859886 17:50599333-50599355 GTGATGCCAGTGAGGCTCCCAGG + Intronic
1150157170 17:62863750-62863772 TTGGAGTCCATGAGGTTCCTTGG + Intergenic
1152694249 17:81735694-81735716 GTGGTTCCAGGGAGGTTCCCAGG - Intergenic
1156199116 18:34809896-34809918 GCTGTGTCAATGATGCTCCCTGG - Intronic
1156818514 18:41341785-41341807 GTGGTGTGGGTGGGGTTCCCAGG - Intergenic
1158915791 18:62127747-62127769 GTGGTGTGACTGAGGTTCGCTGG + Intronic
1159088583 18:63821481-63821503 GTGATGTTTATGGGGTTCCCAGG - Intergenic
1159766728 18:72500443-72500465 GAGGTGACCATGAAGTTCCCTGG + Intergenic
1160166189 18:76514543-76514565 ATGGTGTCACTGTGTTTCCCAGG - Intergenic
1160267600 18:77353742-77353764 GGGATGGGAATGAGGTTCCCAGG + Intergenic
1161013401 19:1970793-1970815 GTGGTGGGAATCAGGGTCCCTGG + Intronic
1163725932 19:18923005-18923027 GGGGTGTCACTGAGCTTTCCTGG + Intronic
1164175303 19:22768601-22768623 GTGGTGGCAATGAGATTTCAAGG + Intronic
1164930136 19:32168983-32169005 GTGGAGTCAATCAGGCACCCAGG + Intergenic
926250372 2:11152502-11152524 GTGGTTTCAATGAGACTCCTTGG + Intergenic
927064699 2:19459881-19459903 GTGGTGTCAGTGTGGTTAACTGG - Intergenic
927707619 2:25306563-25306585 GTGGTGCCCATCTGGTTCCCAGG + Intronic
931058581 2:58501215-58501237 GTGGTGTGAGTTAGGTTCCTTGG + Intergenic
934952234 2:98584541-98584563 GTGGTGTCCTTGAGGCCCCCTGG - Intronic
935879626 2:107550906-107550928 GTGATGTCAATGAGTTTGCAGGG + Intergenic
938971529 2:136437573-136437595 GTAGTGTCAGTGGGTTTCCCAGG - Intergenic
939464997 2:142545550-142545572 GTGGAGACAAGGAGGTTCCAGGG - Intergenic
941083869 2:161093717-161093739 GAGGTGTCACTGTGTTTCCCAGG - Intergenic
945657579 2:212644167-212644189 GTGGACTCTATGAGGGTCCCTGG + Intergenic
945658358 2:212653707-212653729 CTGGTGTTAATGCGGTTCCATGG + Intergenic
1173834332 20:46115369-46115391 GTGGCTTTAATGAAGTTCCCTGG + Intergenic
1174276839 20:49410019-49410041 TTGCTGTCAATGAAGATCCCAGG + Intronic
1176290662 21:5042908-5042930 GTGGAGGCAGAGAGGTTCCCGGG - Intergenic
1178713666 21:34943603-34943625 GTGGGGTCAATGATTTTACCAGG + Intronic
1178936854 21:36870257-36870279 GTGGTGTCAATGAGGTTCCCGGG - Intronic
1179591864 21:42414403-42414425 ATGCTGCCAATGAGGTTCACTGG - Intronic
1179818384 21:43922474-43922496 GTGGGGTTAAGGAGGGTCCCAGG - Intronic
1179866593 21:44220733-44220755 GTGGAGGCAGAGAGGTTCCCGGG + Intergenic
1182298831 22:29326946-29326968 GTGGTGTCACTGTGCTGCCCTGG - Intergenic
1184182199 22:42837268-42837290 GTGGTCTCACTTTGGTTCCCAGG - Intronic
1184919331 22:47594558-47594580 GGGGTGCCAAGGAGGTTCCCCGG + Intergenic
949204504 3:1421776-1421798 GTGATGTGAATGAGGCTACCTGG + Intergenic
949763155 3:7495492-7495514 GTGGTGACAAAGAGGCTTCCTGG + Intronic
950902695 3:16512460-16512482 GTGGTGTCAGTGAGTTTCTTCGG - Intronic
952414320 3:33076522-33076544 GTGGTGACAATGAGGTGGGCAGG + Intronic
953410192 3:42686525-42686547 AGGGTGTCATTGAGGATCCCAGG - Exonic
953881140 3:46692067-46692089 GTGGTGTGACTCAGTTTCCCAGG - Intronic
959875164 3:111373632-111373654 GGGGTGGCGGTGAGGTTCCCAGG - Intronic
962014586 3:131426827-131426849 GTTGTGTCACTCTGGTTCCCTGG - Intergenic
962473111 3:135731374-135731396 GTGGTGTCCATGCACTTCCCAGG - Intergenic
967910239 3:194536701-194536723 GTGGTCTCATTAAGGTGCCCAGG + Intergenic
968743123 4:2341218-2341240 GTGGTTTTTATGAGGTTCACAGG - Intronic
971093227 4:23369694-23369716 GTGTTGGCAGTCAGGTTCCCAGG - Intergenic
972182984 4:36492228-36492250 GTGGTGTCAATGCATTGCCCAGG - Intergenic
979361594 4:119771750-119771772 GTGGAGTAAATGAGGATCACAGG + Intergenic
986873714 5:12081045-12081067 GGGATGTCAATGAGGCTCCAGGG - Intergenic
987642769 5:20633512-20633534 GAGATGTCAATGAGGATCCAGGG - Intergenic
991138715 5:63214285-63214307 GTTCTGTCAATGAGGCGCCCAGG + Intergenic
995742291 5:115367743-115367765 GTGGTGTCCATCAGATTCCTAGG - Intergenic
999435808 5:151562468-151562490 GTGGTGTCAATGAGGGACGCAGG + Intronic
1001540124 5:172531955-172531977 CTGGTGTCAAGCAGGTGCCCTGG - Intergenic
1006131420 6:31871492-31871514 GTGGTGTCATTGGTGATCCCTGG + Exonic
1006728432 6:36216978-36217000 GTGGTGTAAACAAGGTTCACTGG - Intronic
1007696404 6:43736837-43736859 GGGGTGTCTAAGAGGTCCCCTGG + Intergenic
1009332453 6:62440952-62440974 GTGGTCTCTGTGAGGGTCCCTGG + Intergenic
1013721057 6:113028452-113028474 GCGGAGTCAAGGAGGTTGCCGGG + Intergenic
1018986020 6:168637877-168637899 CAGGTGTCAATGTGTTTCCCAGG + Intronic
1019694179 7:2435683-2435705 GTGGTGTCCCTGTGTTTCCCAGG + Intergenic
1020074784 7:5250706-5250728 TTGGTGCTAGTGAGGTTCCCAGG + Intergenic
1023956887 7:44893718-44893740 GTGCTGACACTGAGATTCCCAGG + Intergenic
1024420994 7:49166491-49166513 GTGGTATCACTTAGCTTCCCAGG - Intergenic
1024745369 7:52399976-52399998 GGGTTGGCAGTGAGGTTCCCAGG + Intergenic
1025204324 7:56983104-56983126 TTGGTGCTAGTGAGGTTCCCAGG - Intergenic
1025581722 7:62728080-62728102 TTGGTGTCAATGAGCTCCCAAGG - Intergenic
1025667615 7:63593830-63593852 TTGGTGCTAGTGAGGTTCCCAGG + Intergenic
1029151205 7:98481846-98481868 GTGGTGTCACTAGGGTTGCCTGG + Intergenic
1030617205 7:111750531-111750553 GTGGAGTCCCTGAGGTTCACAGG - Intronic
1032094315 7:128929961-128929983 GTGATGTCCAGGAGGCTCCCTGG - Intergenic
1032630033 7:133640543-133640565 GTGGGGCCAAGGAGGTTCTCAGG + Intronic
1034816229 7:154174136-154174158 GTGGTGTGACTCAGGTCCCCCGG - Intronic
1039476181 8:37840507-37840529 GGGGTGCCACTCAGGTTCCCAGG - Intronic
1045650384 8:104336868-104336890 GTGGTCTCACTGTGTTTCCCAGG + Intronic
1047425700 8:124743573-124743595 GTGGTGCCAATGAAGTTCAAAGG - Intergenic
1051857796 9:21589239-21589261 GATGTGTCAATCAGGATCCCAGG + Intergenic
1056900383 9:90593850-90593872 GTGGTTTTAATGAGGTCCCAGGG - Intergenic
1057026296 9:91736376-91736398 GGGGTGACAATGAGGATCCAAGG - Intronic
1058311046 9:103503203-103503225 AAGGTGTAAATGAGGTTTCCTGG + Intergenic
1188582316 X:31728994-31729016 GTTGTGTCAGTGAGTTTCCATGG - Intronic
1189749204 X:44202681-44202703 GTGGTGTCACTGCCGTGCCCAGG + Intronic
1189855800 X:45223872-45223894 GTGGTGTCAGAGAGGTTACTGGG - Intergenic
1193360896 X:80577135-80577157 GTAGTGGCACTGAGTTTCCCTGG - Intergenic
1194603161 X:95948614-95948636 GTGGTGTCATTCATGTTCCAGGG + Intergenic
1200211392 X:154348228-154348250 GTGGTGTCAGGAAGGCTCCCTGG - Intergenic