ID: 1178937946

View in Genome Browser
Species Human (GRCh38)
Location 21:36880824-36880846
Sequence CCCTCCCAGAGCACTCCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 167}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178937937_1178937946 2 Left 1178937937 21:36880799-36880821 CCACATCTGCCCAAACTCCCCTT 0: 1
1: 0
2: 1
3: 32
4: 341
Right 1178937946 21:36880824-36880846 CCCTCCCAGAGCACTCCTTAGGG 0: 1
1: 0
2: 3
3: 20
4: 167
1178937938_1178937946 -7 Left 1178937938 21:36880808-36880830 CCCAAACTCCCCTTACCCCTCCC 0: 1
1: 0
2: 5
3: 49
4: 557
Right 1178937946 21:36880824-36880846 CCCTCCCAGAGCACTCCTTAGGG 0: 1
1: 0
2: 3
3: 20
4: 167
1178937935_1178937946 13 Left 1178937935 21:36880788-36880810 CCAAGACCACTCCACATCTGCCC 0: 1
1: 0
2: 2
3: 23
4: 255
Right 1178937946 21:36880824-36880846 CCCTCCCAGAGCACTCCTTAGGG 0: 1
1: 0
2: 3
3: 20
4: 167
1178937939_1178937946 -8 Left 1178937939 21:36880809-36880831 CCAAACTCCCCTTACCCCTCCCA 0: 1
1: 0
2: 7
3: 71
4: 708
Right 1178937946 21:36880824-36880846 CCCTCCCAGAGCACTCCTTAGGG 0: 1
1: 0
2: 3
3: 20
4: 167
1178937934_1178937946 19 Left 1178937934 21:36880782-36880804 CCTCATCCAAGACCACTCCACAT 0: 1
1: 0
2: 0
3: 9
4: 173
Right 1178937946 21:36880824-36880846 CCCTCCCAGAGCACTCCTTAGGG 0: 1
1: 0
2: 3
3: 20
4: 167
1178937933_1178937946 25 Left 1178937933 21:36880776-36880798 CCACGACCTCATCCAAGACCACT 0: 1
1: 0
2: 3
3: 11
4: 151
Right 1178937946 21:36880824-36880846 CCCTCCCAGAGCACTCCTTAGGG 0: 1
1: 0
2: 3
3: 20
4: 167
1178937936_1178937946 7 Left 1178937936 21:36880794-36880816 CCACTCCACATCTGCCCAAACTC 0: 1
1: 0
2: 1
3: 34
4: 343
Right 1178937946 21:36880824-36880846 CCCTCCCAGAGCACTCCTTAGGG 0: 1
1: 0
2: 3
3: 20
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178937946 Original CRISPR CCCTCCCAGAGCACTCCTTA GGG Intronic
903654520 1:24941217-24941239 CGCTCCCCAAGCACTCCTCATGG + Intronic
905062638 1:35152792-35152814 TCCTCCTAGAGGAATCCTTATGG - Intergenic
907680774 1:56561141-56561163 CCGGCCCAGAGCCCTCTTTAAGG + Intronic
910121516 1:83795600-83795622 TCCTCCCAGAGCACTTATTTTGG - Intergenic
911103941 1:94115631-94115653 ACCTCCCAGAGCAGTCGTGAGGG + Intronic
913372633 1:118117661-118117683 ACCACCCAGGGCACTCCTCAAGG - Intronic
914920034 1:151840143-151840165 CTCCCCCAGCGCAGTCCTTATGG + Intronic
916572115 1:166037115-166037137 CCCTCCCAGTGCACACAATAAGG - Intergenic
919072291 1:192771572-192771594 TCCTCCCAGAGGAATCTTTATGG + Intergenic
920200247 1:204255812-204255834 CCCTTCCTGAGAACTCCTCAAGG - Intronic
924133651 1:240939684-240939706 CCCTCCCAGAGGAATCTTTATGG - Intronic
1062798458 10:361790-361812 CCCTTTCAGAGCACTCCCTGAGG + Intronic
1063053092 10:2474783-2474805 CCCCCCGAGGGCACTCCTTCTGG - Intergenic
1065444818 10:25787470-25787492 CCCTCCCAGAGAACACCTACAGG + Intergenic
1065515122 10:26517028-26517050 CCCTCCCAGAGGAATCTTGATGG + Intronic
1068131550 10:52901509-52901531 CTCTCCCAGAGGATTCTTTATGG + Intergenic
1070373154 10:75804671-75804693 CCCTCCCAGAGCAAGCCCCACGG - Intronic
1070381294 10:75882802-75882824 CCCTTCCAGGGCCCTCCTGATGG + Intronic
1072985377 10:100134937-100134959 GCCTCCCAGACCTCACCTTATGG + Intergenic
1075389900 10:122084547-122084569 CCCTCCCAGATGGCTCCTTCGGG - Exonic
1076328092 10:129644169-129644191 CTCTCCCAGAGCAGTGCTTTAGG + Intronic
1077319751 11:1935918-1935940 CCCTCCCAGAGCTGTCCCCAGGG + Intronic
1079702288 11:23563715-23563737 CCCTCCCAAACCACACCTCAAGG + Intergenic
1080241229 11:30129336-30129358 CCATCCCCAAGCACTCCTTCTGG - Intergenic
1081634588 11:44712348-44712370 CCCTCCCAGGGCCCTCCATATGG + Intergenic
1083029851 11:59582484-59582506 CCCTCCCAGACCTCACCCTACGG + Intronic
1089305435 11:117523500-117523522 CCATCCCAGAGCATTTCTTGGGG + Intronic
1091847540 12:3669043-3669065 CCCTCCCAGAGCACAGCCTAGGG + Intronic
1092559408 12:9594886-9594908 CCCTCCCAGAGGAATCTTCACGG + Exonic
1094137356 12:27142344-27142366 CCCTTTCAGAGAACTCCTCAGGG - Intergenic
1094544200 12:31389222-31389244 CCCTTCCAGAGCTCTCCTTTGGG - Intronic
1095415124 12:41968239-41968261 CCCTCCCAGTGCGCTGCTAATGG + Intergenic
1106230056 13:27814714-27814736 CCCTCCTAGAGCTCTTCTTCTGG + Intergenic
1107105801 13:36641196-36641218 CTGCCCCAGAGCACTCCTGATGG + Intergenic
1110347254 13:74463153-74463175 CCCTGCCAGGGGAATCCTTATGG - Intergenic
1112498595 13:99925117-99925139 CCCTCCCAGAGCAATCATCTGGG + Intergenic
1117206597 14:53449921-53449943 CCCTCACAGCACACTCCTCATGG - Intergenic
1118846620 14:69552199-69552221 CCCTCCCACAGCATGCCTGATGG - Intergenic
1120297068 14:82655490-82655512 CCCTCCCAGAGAAATCTTTACGG + Intergenic
1120915276 14:89704868-89704890 CACTCTCAGAGAACTTCTTAGGG - Intergenic
1122365451 14:101192495-101192517 CTGTCCCAGAGGACTCCGTAGGG + Intergenic
1122687453 14:103516497-103516519 GCCTCCCAGAGCACCCTTCAGGG - Intergenic
1123603875 15:22003970-22003992 CCATCCCAGTGCTCTCTTTATGG + Intergenic
1124701190 15:31913984-31914006 CCCTCCCACAGCACTTCCTTTGG + Intergenic
1124955264 15:34356118-34356140 CCTTCCCAGGGCACTGCTAAAGG - Exonic
1126441831 15:48697752-48697774 CCCCTCCAGAGCACTTCTGAAGG - Intergenic
1127490722 15:59460049-59460071 CCCTCGTAGAGCACGCCTTTCGG + Exonic
1128152749 15:65373425-65373447 GCCTCCCAGCGAACTCCATATGG + Intronic
1129262564 15:74376885-74376907 CCCTCCCAGAACACACCTGTGGG + Intergenic
1131636214 15:94235508-94235530 CCCTCCCAGTGATCTCCATAAGG - Intronic
1134095614 16:11416558-11416580 CCCTCACAGAGCACACATTCTGG + Intronic
1134628619 16:15740879-15740901 CTCTCTCAGATCACTCCTTCTGG + Intronic
1136067905 16:27771054-27771076 CCTTCCCAGAGCACTCCCTGAGG + Intronic
1136354863 16:29737805-29737827 CCCTCCCTCTGCACTCCTTCTGG - Intergenic
1137645142 16:50066798-50066820 CTCTCCAAAAGCCCTCCTTAGGG + Intronic
1139552852 16:67685298-67685320 CCCTCCCCAAGCACTGCTTCAGG + Intronic
1140039056 16:71393360-71393382 CCCTTCCAGAGCTCTCACTATGG - Intergenic
1141792002 16:86243262-86243284 CCCTCCCAGTGCTTGCCTTACGG + Intergenic
1142762954 17:2052017-2052039 CGCTCCCAGAGCTCACGTTAGGG + Intergenic
1143037222 17:4006302-4006324 CCCTCCCAGAGAACTCCTTGAGG - Exonic
1143765378 17:9134368-9134390 TCCCCCCAGAGCACTCCCTCCGG + Intronic
1144055025 17:11532945-11532967 CACTCCCAGAGAACTTCTCAGGG + Intronic
1144491290 17:15712365-15712387 CCATCCTAGAGCTCTCCTCAGGG + Intronic
1144910168 17:18674128-18674150 CCATCCTAGAGCTCTCCTCAGGG - Intronic
1146807700 17:35878467-35878489 TCCTCTCAGAGGACTCCTCAGGG + Intronic
1148086826 17:44998637-44998659 CCCTCCCTGACCCCTCCTAAAGG - Intergenic
1150343733 17:64388288-64388310 CCCTCCCAGACCACACCCTTTGG - Intronic
1150737702 17:67754458-67754480 GCCTCCCAAAGCACAGCTTATGG - Intergenic
1151920111 17:77148240-77148262 CTCTCCCACAACTCTCCTTAAGG - Intronic
1152566672 17:81103406-81103428 CCCTCCCTGAGCACTCTCTGGGG - Intronic
1155446936 18:25922471-25922493 GCCTCCCAGAGGAATCCTTATGG - Intergenic
1157478360 18:48037378-48037400 CCCTCCCAGCACATTCCTGATGG - Intronic
1158213977 18:55080069-55080091 TCCTTCCGGAGCACTCCTTTTGG + Intergenic
1158272531 18:55732498-55732520 CCTTCCCAGAAAAGTCCTTAAGG - Intergenic
1158636863 18:59166591-59166613 ACCACCCAGAACACTCCTCAAGG + Intergenic
1159923811 18:74249279-74249301 GTCTCCCAGGGCACTCCTGAGGG + Intergenic
1161952348 19:7474871-7474893 GCCTTCCTCAGCACTCCTTATGG + Intergenic
1162705108 19:12549765-12549787 TCCTCCCAGAGGACAGCTTAAGG - Intronic
1163632360 19:18423974-18423996 CCCTCCCAGAGGACTGCTCCGGG - Intronic
1166201837 19:41242802-41242824 CCCTCCCACATCACCCCTTTGGG + Intronic
1166732481 19:45067026-45067048 CCCTCCCAGAGCTCACCTCCCGG + Intronic
1166999578 19:46737998-46738020 CACTCTCAGAGCCCTCCCTATGG - Intronic
1167350024 19:48968736-48968758 CCCTCCCAGAGCCCCACTTCTGG + Exonic
925168839 2:1738386-1738408 CCCTCCCAGAGCACTGATGTGGG + Intronic
925805367 2:7643319-7643341 CCCTCCCAGAGTCATCTTTATGG - Intergenic
927163918 2:20298123-20298145 CCCTCACAAAGCACTCCATCTGG + Intronic
927456029 2:23250109-23250131 CCCTTCCAGAGAACTCATTTGGG - Intergenic
927508623 2:23630400-23630422 CCATCCCAGAGCACATCTGAAGG + Intronic
927959955 2:27234971-27234993 CCTTCCCAGATCACCCCTTTTGG - Intronic
928312127 2:30219923-30219945 CCATCCCAGAAAACTCCCTATGG - Intergenic
928433820 2:31240878-31240900 CCCTTGCAGAGCCCTGCTTAGGG + Intronic
929501534 2:42494444-42494466 CCTTCCCTGAGAAATCCTTAGGG - Intergenic
930362568 2:50400379-50400401 CCCCCCAATAGCACTCCTTATGG - Intronic
934852005 2:97707483-97707505 CCCTCCCAGAGCTCTCCACTGGG + Intergenic
935915117 2:107941242-107941264 CCCTCCCTGAGCAGTCTTTATGG + Intergenic
936075006 2:109396192-109396214 CCCTCCCACAGCCCTCCGTGGGG - Intronic
937635352 2:124149885-124149907 CCCTCTCAGACCATTCCTGATGG + Intronic
937891465 2:126942082-126942104 CCCTCCCAGAGGACTCGTAATGG + Intergenic
941312409 2:163950623-163950645 CCCTCCCGGATCACACCTTCAGG - Intergenic
942990824 2:182200558-182200580 CCCTCCCAGACCTTTCCTTATGG + Intronic
1168984821 20:2039064-2039086 CCCTCCTAAACCACTCCTCATGG + Intergenic
1169293349 20:4371494-4371516 CCCTCCAAGGGCATTCCTGAGGG - Intergenic
1169977039 20:11341175-11341197 CTCTCCCAGAGCACAGCTCAGGG - Intergenic
1171398932 20:24859200-24859222 ACCTCCCAGTGCTCTCCTTTGGG - Intergenic
1174757211 20:53171401-53171423 CCCTCCCAGGGGACTCATAAGGG - Intronic
1177001615 21:15620162-15620184 CCCTCCCAGTACACTTCTGATGG - Intergenic
1178188236 21:30249437-30249459 CCTTCCCTGAGCACTCTTTCTGG - Intergenic
1178284806 21:31316700-31316722 CCTTCCCAGAGCCATCCTGAGGG - Intronic
1178667584 21:34562460-34562482 CTCTCCCACATCACTCCTTGGGG - Intronic
1178937946 21:36880824-36880846 CCCTCCCAGAGCACTCCTTAGGG + Intronic
1179451429 21:41470895-41470917 CCCTGCCAGACCTCTCCTTCTGG + Intronic
1179774938 21:43655710-43655732 ACCTCCCAGAGCACACCACAGGG + Intronic
1181487786 22:23242388-23242410 CCCTCCCAGAGGAATCTTTATGG + Intronic
1182711907 22:32328455-32328477 CTCTCCCAGAGCCCTCTTTTTGG + Intergenic
1183307510 22:37090451-37090473 GCCTCCCAGACTCCTCCTTAGGG - Intronic
1183865486 22:40700998-40701020 CCCTCCCAGAGGAATCCTTATGG - Intergenic
1184399455 22:44265326-44265348 CTCTCCCAGAGCCCTCTTTTTGG + Intronic
1184908469 22:47508995-47509017 CCCTCAAAGAGCTCTCCTTTGGG - Intergenic
956929412 3:74025665-74025687 TCCTACCAGAGCCCTCCTGAGGG - Intergenic
961562379 3:127739684-127739706 CCATCCCAAAGCCCTCCATAAGG - Intronic
961625642 3:128261848-128261870 CACTTTCAGAGCACTCCCTAAGG - Intronic
962069081 3:132014251-132014273 CCCTCTCAGAGCCTTCCCTAAGG + Intronic
969638365 4:8382331-8382353 GCCTCCCACAGTACTCCGTATGG + Intronic
971493270 4:27237010-27237032 CCCTCCCAAAGGAATTCTTATGG + Intergenic
971834755 4:31748552-31748574 CCCTCCCAGATGACTCAGTAGGG + Intergenic
975926796 4:79465128-79465150 CCCTCTCAGAGCATTACTCAGGG - Intergenic
976838269 4:89401026-89401048 CCCTCCTAGAGCACTGCCCATGG + Intergenic
980087918 4:128410470-128410492 CCCTCCCCAAGGACTCCTGAGGG + Intergenic
980348151 4:131651698-131651720 CCCTCCCAGAGGAATATTTATGG - Intergenic
980522807 4:133954005-133954027 CCCTCTCAGAGAAGTCCCTATGG - Intergenic
984101707 4:175495185-175495207 CGCTCCCAGAGCCCTCCTGCAGG - Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
985837163 5:2280044-2280066 CCCTCCCAGCTCACCCCTTGAGG - Intergenic
987092058 5:14516895-14516917 CCCTCCCAGAGGAATCTTTATGG + Intronic
987168034 5:15221231-15221253 CTCTACCAGTGCATTCCTTATGG + Intergenic
988592686 5:32562673-32562695 CCCTCCCAGAGGAGCCTTTATGG + Intronic
992488310 5:77216705-77216727 CCCTCCCTGTCCACTCCTGAAGG - Intronic
996149302 5:120016058-120016080 ACCTCCCAGAGGAATCTTTATGG - Intergenic
997933719 5:138092565-138092587 AGCTCCCAGGGCTCTCCTTATGG - Intergenic
998251535 5:140557040-140557062 CTCTCCCCGAGGGCTCCTTAAGG - Intronic
1001068528 5:168561286-168561308 CAATCCCAGAGGCCTCCTTAGGG + Intronic
1001413778 5:171528933-171528955 CCTTCCCCGAGGGCTCCTTACGG + Intergenic
1001701212 5:173707729-173707751 CCCTCCCAGAGCTCTCAGCATGG + Intergenic
1002297930 5:178241644-178241666 CCCTCCCAGGGCACCGCTGATGG + Intronic
1006510482 6:34518632-34518654 CCCTCCCAGAGCTCTCCAGCGGG - Intronic
1006862697 6:37183511-37183533 TCCTCCCACAGCACTGCTGAGGG - Intergenic
1009725233 6:67529791-67529813 CCCTCCCAGAGGTCTACCTAAGG + Intergenic
1011453080 6:87516376-87516398 CCCTCCCAGGACAATGCTTATGG + Intronic
1012074263 6:94664447-94664469 CCCTCCCAGACCTTTCCCTATGG - Intergenic
1014787509 6:125635204-125635226 CTCTCCCACAGCTCTCCCTATGG - Intergenic
1015616250 6:135078431-135078453 CACTCCCAGAGCCATCCTCATGG + Intronic
1019320288 7:412007-412029 CCCTCCCTGATCACCCGTTATGG - Intergenic
1026473112 7:70711127-70711149 CCCCCCCAGAGCACACCTTCGGG + Intronic
1027336159 7:77152688-77152710 TTGTCCCAGAGCACTCCTTTAGG - Intronic
1029724964 7:102396655-102396677 CCCTCCAAGAGCAGTCTTTGGGG + Intronic
1029779630 7:102718414-102718436 TTGTCCCAGAGCACTCCTTTAGG + Intergenic
1032441739 7:131947501-131947523 TCCACCCATAGCTCTCCTTAGGG - Intergenic
1032574649 7:133040395-133040417 CCCTCCCAGAGGAATCTTGATGG - Intronic
1032703904 7:134405741-134405763 CTCTCCTAGAGCACTTCTTGTGG - Intergenic
1033834121 7:145288250-145288272 CCCTCTCAGAACTCTCCTTCAGG - Intergenic
1033904054 7:146179311-146179333 CCCTCCCCAAGTATTCCTTACGG - Intronic
1037048038 8:14334177-14334199 CCCTACCAAAGCACTCCTTAGGG + Intronic
1037052880 8:14398587-14398609 TTCTCCCAGAGCACTCCCCAAGG - Intronic
1037313928 8:17583221-17583243 CCCTACCAGGGCACTGCCTAGGG + Intronic
1037742753 8:21620505-21620527 GCCTCCCAGAGCACACAGTAGGG + Intergenic
1038941332 8:32309169-32309191 CCCTCCCAGAGGAATCTTTATGG - Intronic
1039988450 8:42467699-42467721 TCCTCCCAACGCACGCCTTAAGG - Intronic
1040632452 8:49231013-49231035 CCCTCCCAGAGGAATCTTTATGG + Intergenic
1041915084 8:63131014-63131036 TGTTCCCAGAGCACTCCTCAAGG - Intergenic
1043394725 8:79825442-79825464 TCCTCCCAGAGCACCACTTTGGG + Intergenic
1044529217 8:93289162-93289184 CCCTCACAGAGCATTGCTTGTGG + Intergenic
1045917383 8:107488382-107488404 CCCTCCAAGAGCATTCCGCAGGG - Intronic
1046047243 8:108978747-108978769 ACCTCCAAGACCACTCTTTATGG + Intergenic
1046914987 8:119670517-119670539 CCATCCCACACCAGTCCTTAGGG - Intronic
1047196522 8:122726702-122726724 CCTTCCCAGACCACACCTCATGG + Intergenic
1047603703 8:126452933-126452955 CCCTCCCTGAGCACATTTTAAGG - Intergenic
1049084770 8:140470239-140470261 TCCTCTCAGAGCACTCCCCAAGG + Intergenic
1049383165 8:142327546-142327568 CCCTCACAGAGCCCTCCATCGGG + Intronic
1049784796 8:144445104-144445126 CCCTCCCAAAACAGTCCTTGGGG - Intergenic
1053300535 9:36946119-36946141 TCCTGACAGAGCACTCCTCAGGG - Intronic
1056932740 9:90892380-90892402 CCTTCCCAGAGGAATCTTTATGG + Intronic
1061504261 9:131022169-131022191 GACTCCCATAGCCCTCCTTACGG - Intronic
1061836568 9:133333577-133333599 CTCTCCCAGAGCACACCTGCTGG + Intronic
1062349238 9:136131130-136131152 CCCTACTAGAGCACTCCTAGAGG - Intergenic
1185814852 X:3145386-3145408 CCCTCCCAAAGGAATCTTTATGG - Intergenic
1187394730 X:18909457-18909479 CCCTCCCAGAGGCATCCTTATGG - Intronic
1187520168 X:20006077-20006099 CCCTCCCAGAGGTCTGCATATGG + Intergenic
1188679391 X:32983049-32983071 CCCTCCCAGAGGAATCTTTATGG - Intronic
1189675150 X:43453778-43453800 CCCTCCCAGAGGAATCTTTATGG - Intergenic
1190728846 X:53211186-53211208 CACTCCCTGAACACTACTTATGG + Intronic
1196124694 X:112084741-112084763 CTCTCCCTGAGCACTGCTTCTGG - Intergenic