ID: 1178938118

View in Genome Browser
Species Human (GRCh38)
Location 21:36881832-36881854
Sequence GCACCATTTTACTTGAAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 120}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178938113_1178938118 -1 Left 1178938113 21:36881810-36881832 CCCATGTGGACAGGGGGGCTCTG 0: 1
1: 0
2: 0
3: 13
4: 201
Right 1178938118 21:36881832-36881854 GCACCATTTTACTTGAAAGGGGG 0: 1
1: 0
2: 1
3: 12
4: 120
1178938110_1178938118 5 Left 1178938110 21:36881804-36881826 CCAGGACCCATGTGGACAGGGGG 0: 1
1: 0
2: 1
3: 17
4: 189
Right 1178938118 21:36881832-36881854 GCACCATTTTACTTGAAAGGGGG 0: 1
1: 0
2: 1
3: 12
4: 120
1178938108_1178938118 6 Left 1178938108 21:36881803-36881825 CCCAGGACCCATGTGGACAGGGG 0: 1
1: 0
2: 0
3: 28
4: 202
Right 1178938118 21:36881832-36881854 GCACCATTTTACTTGAAAGGGGG 0: 1
1: 0
2: 1
3: 12
4: 120
1178938104_1178938118 20 Left 1178938104 21:36881789-36881811 CCTCTGAGAAGGCTCCCAGGACC 0: 1
1: 0
2: 2
3: 31
4: 294
Right 1178938118 21:36881832-36881854 GCACCATTTTACTTGAAAGGGGG 0: 1
1: 0
2: 1
3: 12
4: 120
1178938114_1178938118 -2 Left 1178938114 21:36881811-36881833 CCATGTGGACAGGGGGGCTCTGC 0: 1
1: 0
2: 1
3: 19
4: 228
Right 1178938118 21:36881832-36881854 GCACCATTTTACTTGAAAGGGGG 0: 1
1: 0
2: 1
3: 12
4: 120
1178938102_1178938118 25 Left 1178938102 21:36881784-36881806 CCTGGCCTCTGAGAAGGCTCCCA 0: 1
1: 0
2: 2
3: 22
4: 304
Right 1178938118 21:36881832-36881854 GCACCATTTTACTTGAAAGGGGG 0: 1
1: 0
2: 1
3: 12
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178938118 Original CRISPR GCACCATTTTACTTGAAAGG GGG Intronic
901241021 1:7693435-7693457 GCTCCCTTTAACTTGACAGGTGG - Intronic
901356274 1:8652191-8652213 GCACCCTTTTGCTTGAGTGGGGG - Intronic
902202476 1:14844252-14844274 AAATCATTTTACTTAAAAGGTGG - Intronic
903099041 1:21011919-21011941 ATGCCATTTTACTTGAAAGAAGG + Intronic
906484544 1:46224075-46224097 CCACCATTTTTCTGGGAAGGAGG + Intergenic
912977309 1:114342386-114342408 CAACCTTTTTACTTAAAAGGGGG + Intergenic
917315769 1:173723732-173723754 GTACCATGCTACTTAAAAGGGGG - Intronic
918521828 1:185423390-185423412 GGTCCATTTTGCCTGAAAGGAGG + Intergenic
919053962 1:192545625-192545647 TTACCATTTTATTTTAAAGGTGG - Intergenic
919396568 1:197057147-197057169 GCACCATTTTCAATGAAGGGTGG + Exonic
922946568 1:229521152-229521174 GAGCCATTTTAGCTGAAAGGCGG - Intronic
923582820 1:235234489-235234511 TCACCCTTTTTCTTAAAAGGTGG - Exonic
1066402472 10:35089900-35089922 GCCCCATTTTCCTTCGAAGGAGG - Exonic
1068144640 10:53052024-53052046 GTACTATTTTACTAGAAAGTAGG + Intergenic
1071573964 10:86712397-86712419 GGCCCTGTTTACTTGAAAGGGGG + Intronic
1072414142 10:95232807-95232829 GACCCATTTTACTGCAAAGGAGG - Intergenic
1074612206 10:115033106-115033128 GAACCATTTCCCTTGAGAGGTGG - Intergenic
1081379170 11:42394255-42394277 TCAATATTTTAATTGAAAGGGGG - Intergenic
1081695857 11:45108643-45108665 GCACCACATTCCCTGAAAGGAGG - Intronic
1082029440 11:47594045-47594067 GGTCCTTTTTCCTTGAAAGGAGG - Intronic
1086642261 11:89174290-89174312 CTACCATTATAATTGAAAGGAGG + Intergenic
1086944838 11:92834851-92834873 TCCCCATTTTTCTTCAAAGGGGG + Exonic
1087326858 11:96734718-96734740 GAACCATTTTCTTTGAAAGCTGG - Intergenic
1087980696 11:104610077-104610099 TCAGCATTTTACTACAAAGGTGG + Intergenic
1091604408 12:1937768-1937790 GCACCACCTTAATTGCAAGGCGG - Intergenic
1092641081 12:10510509-10510531 GGACAATTTTCCTTGACAGGAGG + Intronic
1097458505 12:59831810-59831832 AAACCATTTTACTTTAAAGCGGG - Intergenic
1097935531 12:65245447-65245469 GCACTCTTTTACTGGAAAGTGGG + Intronic
1102027290 12:109720724-109720746 GCCCCAGTTGCCTTGAAAGGTGG + Intronic
1102526903 12:113519133-113519155 GCACAATATTACTTGGTAGGAGG + Intergenic
1102658957 12:114508310-114508332 GCACCATTTGGCTTCCAAGGAGG - Intergenic
1106228615 13:27803877-27803899 AAACCATTTTACTTGAAAGAAGG + Intergenic
1110544852 13:76744836-76744858 GTATCATTTTACTTAAAAGTTGG + Intergenic
1117534666 14:56692504-56692526 GCCTCATTTTACTTGACAAGTGG + Intronic
1118581434 14:67303763-67303785 GCACCTTTTTTTTTGGAAGGTGG + Intronic
1119123194 14:72098758-72098780 GTACCATTTTACAGGAAATGAGG - Intronic
1119986121 14:79139829-79139851 GCAGCATTTAATTTTAAAGGTGG - Intronic
1120493096 14:85201637-85201659 ACATCATTTTATTTTAAAGGAGG + Intergenic
1121252772 14:92512472-92512494 GCACCATTTTACATCCCAGGGGG + Intergenic
1124575568 15:30904795-30904817 GCACCATTTTACTGCAAACGGGG - Exonic
1131580490 15:93638187-93638209 GCCCCATTTTACAGCAAAGGAGG - Intergenic
1135837296 16:25838005-25838027 TAACCACTTTAATTGAAAGGAGG + Intronic
1141062506 16:80886961-80886983 GCAACATTTTACTCAAAAGTTGG - Intergenic
1142888480 17:2928163-2928185 GCCCAATTTTACTTGAAGGAAGG + Intronic
1144997424 17:19279780-19279802 AGACCATTTTACTGGGAAGGAGG + Intronic
1149520182 17:57312798-57312820 GCACCATTATAGTTCCAAGGGGG + Intronic
1152015906 17:77750019-77750041 GCCCCTTTTAATTTGAAAGGGGG - Intergenic
1155442692 18:25878550-25878572 GTAACATTTTACTTGTTAGGAGG - Intergenic
1156905997 18:42352677-42352699 GCCAGATTTTACCTGAAAGGTGG + Intergenic
1159490434 18:69126747-69126769 GTAACATTTTATTTGATAGGTGG + Intergenic
1163773028 19:19202195-19202217 GCACCATTTTACAGAAAAAGTGG + Intronic
1165584792 19:36904810-36904832 GTACCTTTGTACTTGAAAGGTGG - Intronic
1166842919 19:45709901-45709923 TCACCATTTTGCTGGAAGGGAGG - Intergenic
926326282 2:11786898-11786920 GCACCATTTTACCTGGAAGGCGG - Intronic
930532450 2:52606974-52606996 CCCCCATTTTACTTGAAAAATGG + Intergenic
930843831 2:55879699-55879721 GCACCATGCTACTTGAAGTGTGG + Intronic
932926728 2:75984552-75984574 GCAGCAGTTTACTGGAAGGGGGG + Intergenic
935442067 2:103110619-103110641 GCACCATTTTATGAGAAAAGTGG + Intergenic
936166703 2:110127046-110127068 GGTCCATTTAACTTCAAAGGAGG - Intronic
944560498 2:200932029-200932051 ATAATATTTTACTTGAAAGGTGG - Intronic
947878622 2:233485550-233485572 GCACCGTATTACTTGAAAGACGG - Exonic
948880999 2:240857057-240857079 GCACCATTTTAATTGAACCCCGG - Intergenic
1169002883 20:2180761-2180783 GCACTCTTTTACTTGCAAAGGGG - Intergenic
1177081984 21:16651143-16651165 GCAGCAGTTTAGTTGGAAGGAGG - Intergenic
1178938118 21:36881832-36881854 GCACCATTTTACTTGAAAGGGGG + Intronic
1182091841 22:27601257-27601279 CCTCCATTTTACTTAAAGGGCGG - Intergenic
1182681678 22:32084520-32084542 GTAGCATTTTTCCTGAAAGGTGG - Exonic
1182778693 22:32850390-32850412 GGGCCATGTTACTTGTAAGGAGG + Intronic
1185162448 22:49238084-49238106 GCATCATTTTATTAGAAAGGGGG + Intergenic
949376069 3:3391764-3391786 GTTGCATTTTACTTAAAAGGAGG - Intergenic
952497720 3:33930516-33930538 GCACCACCTTGCTTGAAAGGGGG - Intergenic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
956646482 3:71462256-71462278 TTACCATTTTGTTTGAAAGGCGG + Intronic
957435377 3:80168533-80168555 GGATCATTTTACTAGGAAGGGGG - Intergenic
957807266 3:85164822-85164844 GCACGATTTTAATTTAAAAGTGG - Intronic
974588300 4:63910423-63910445 TCATCATTTTACTTGATAAGTGG - Intergenic
980401037 4:132286246-132286268 GCAGCAATTTACCTGAAAGCAGG + Intergenic
981031284 4:140128171-140128193 GCACCATCTTAATTGAAGGTAGG - Intronic
981189354 4:141842596-141842618 GCAACATTTTCCTTACAAGGTGG - Intergenic
984082375 4:175263550-175263572 GCTCCATTTTAGTTGGAATGTGG + Intergenic
987252597 5:16115597-16115619 GCACCAGTTTAATTGAAACTTGG + Intronic
988437825 5:31195904-31195926 GCACCATTTTCCTTCAAAATTGG - Intronic
990823896 5:59875566-59875588 GCACCATTTAAAGTGCAAGGAGG - Intronic
993588046 5:89757110-89757132 GCTTCATTTTACTTGCAAGCTGG + Intergenic
1000458602 5:161484435-161484457 CCACTTTTGTACTTGAAAGGTGG - Intronic
1001336862 5:170805697-170805719 GCTCCATTTTATTTGCCAGGGGG + Exonic
1004765031 6:18716196-18716218 GCACCATGGTAATTGAAATGGGG + Intergenic
1006220855 6:32489951-32489973 CCACCATTTCACTTTAACGGTGG - Intergenic
1009936554 6:70241352-70241374 GCACCATTTCACAAGCAAGGGGG - Intronic
1011001258 6:82590817-82590839 TCACTATCTTACTTGAAAGTGGG + Intergenic
1012350688 6:98246353-98246375 GCACCACTTTAGTAGAAAGAAGG - Intergenic
1012563538 6:100617407-100617429 GCACTATTTTCCTTGAAATATGG + Intronic
1012652819 6:101778296-101778318 TCACCATTTTTCTTGGAAGATGG - Intronic
1014809229 6:125866718-125866740 GCACCATTATAAATGAGAGGAGG - Intronic
1014973854 6:127853815-127853837 TTCCCATTTTACATGAAAGGAGG + Intronic
1016143447 6:140642260-140642282 GCAGCATTATACTTGTAAGTAGG - Intergenic
1018552199 6:165010639-165010661 TCACCATGTTACTGGAAAAGAGG + Intergenic
1018598087 6:165505459-165505481 TCATCATTTTATTTGAAAGTTGG - Intronic
1020216862 7:6199090-6199112 GCACCCTTTTACTAAAATGGAGG - Intronic
1020467643 7:8499052-8499074 GCATCATCTTACCTGATAGGAGG - Intronic
1026410495 7:70116528-70116550 GCTCCATTTTTCTAGACAGGAGG - Intronic
1027591474 7:80124589-80124611 GAACTATTTTTGTTGAAAGGGGG + Intergenic
1029823217 7:103164404-103164426 GCACAATTTTATTTTAAAGATGG + Intergenic
1029931213 7:104373312-104373334 TCACAATTTTTCTTGAAATGTGG - Intronic
1030262781 7:107583089-107583111 GTAACACTTTAGTTGAAAGGAGG - Intronic
1030745300 7:113158921-113158943 GCCCCATTTTCCTTAAAAAGTGG + Intergenic
1031554115 7:123150503-123150525 ACAATAGTTTACTTGAAAGGAGG - Intronic
1032183900 7:129706655-129706677 ACTCAATGTTACTTGAAAGGTGG - Intronic
1035572594 8:682798-682820 GCACCTTCTTACGTGAAAGTAGG + Intronic
1038472110 8:27833595-27833617 GCCCAATTTTACTTAAAATGAGG + Intronic
1039027977 8:33278802-33278824 GTACCAGTTGAATTGAAAGGTGG + Intergenic
1041806933 8:61861752-61861774 TCACCTTTTTACTTGAAGGAAGG + Intergenic
1044716021 8:95100313-95100335 GAACAATTTAACTTGAAAGCAGG + Intronic
1044949382 8:97420418-97420440 GCACCAAGTTACATGAAATGTGG - Intergenic
1046645021 8:116776634-116776656 GCACCATCTTAGGTGAAAGAGGG + Intronic
1046759581 8:118007462-118007484 GATGCATTTTCCTTGAAAGGAGG - Intronic
1047709136 8:127532980-127533002 GCACCATTGCTCTTGAAATGAGG - Intergenic
1050575254 9:6988296-6988318 GCTCCATTCTACTTTAAAGAAGG - Intronic
1052191312 9:25666231-25666253 TCACCATTTAACTTTAAAGGAGG - Intergenic
1055400418 9:75917802-75917824 TAAACATTTTACTTGAAAAGAGG + Intronic
1056347373 9:85711820-85711842 TCACCATTTTAATAGAAAAGTGG + Intronic
1056536880 9:87536032-87536054 GCCCCATTTCACTTGGGAGGCGG - Intronic
1056543822 9:87596503-87596525 GCAGCACTTTCCTTGAAAGGTGG + Intronic
1056684754 9:88750396-88750418 GCACTACTTTCATTGAAAGGGGG + Intergenic
1057067556 9:92069726-92069748 GCACCATTATACTTTGAAGGAGG - Intronic
1058685530 9:107476744-107476766 ATACCTTTTTTCTTGAAAGGAGG + Intergenic
1187931443 X:24297050-24297072 GCACCATGTTACTCAAAGGGTGG - Intergenic
1190195603 X:48315627-48315649 GCACGATTTTACTCAGAAGGGGG + Intergenic
1190662053 X:52663839-52663861 GCACGATTTTACTCAGAAGGGGG + Intronic
1190974248 X:55384419-55384441 GCACCATTTTACTTGAATCTGGG - Intergenic
1193625653 X:83817315-83817337 GAAGCATTTTACTTGAAAACTGG - Intergenic
1195044183 X:101041268-101041290 GCACCATTCTCCTGGAAAGGAGG + Intronic
1199901098 X:152173217-152173239 GCACCACTTTCCTGTAAAGGCGG + Intronic
1201532281 Y:15005142-15005164 TGACCATTTTATTTGAAAGAAGG - Intergenic