ID: 1178938951

View in Genome Browser
Species Human (GRCh38)
Location 21:36888945-36888967
Sequence TGGGGCTTTGGGCAGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 408}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178938951_1178938960 18 Left 1178938951 21:36888945-36888967 CCTCCTTTCTGCCCAAAGCCCCA 0: 1
1: 0
2: 4
3: 48
4: 408
Right 1178938960 21:36888986-36889008 GTGTACACAACTTTACAAACTGG 0: 1
1: 0
2: 1
3: 5
4: 106
1178938951_1178938957 -4 Left 1178938951 21:36888945-36888967 CCTCCTTTCTGCCCAAAGCCCCA 0: 1
1: 0
2: 4
3: 48
4: 408
Right 1178938957 21:36888964-36888986 CCCAATGATCAGACCAAGAACGG 0: 1
1: 0
2: 1
3: 7
4: 114
1178938951_1178938961 24 Left 1178938951 21:36888945-36888967 CCTCCTTTCTGCCCAAAGCCCCA 0: 1
1: 0
2: 4
3: 48
4: 408
Right 1178938961 21:36888992-36889014 ACAACTTTACAAACTGGCACAGG 0: 1
1: 0
2: 1
3: 16
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178938951 Original CRISPR TGGGGCTTTGGGCAGAAAGG AGG (reversed) Intronic
900618504 1:3576333-3576355 TGGGGCTGTGGGCAGCAGGGAGG + Intronic
900647319 1:3714838-3714860 TGGGGCCTTGGGGACAGAGGGGG - Intronic
900683979 1:3935427-3935449 TGGGCCTTTGGGCCGAAAGGTGG + Intergenic
901023747 1:6268455-6268477 TGGTGCCTAGGGAAGAAAGGAGG - Intronic
901077511 1:6564494-6564516 TAGGGCTATGGGCAGAAGGGAGG + Intronic
901610455 1:10494002-10494024 TGGAGCTTTGGGAGGACAGGAGG + Intronic
901612483 1:10509784-10509806 TGTGGCTTTGGGAGGAAGGGAGG + Intronic
901742637 1:11352281-11352303 AGGGGCTTTGGGCTGGAGGGTGG + Intergenic
901883520 1:12207541-12207563 TGGGGCTCTGTGCAGGGAGGAGG + Exonic
902818240 1:18928176-18928198 TGGGGCTTGGGGCAGGCAGGAGG - Intronic
903330646 1:22595373-22595395 TGGGGCTGGGGGCAGGCAGGAGG - Intronic
904808219 1:33146507-33146529 TCGGCCTGTGGGCAGGAAGGTGG + Exonic
905009288 1:34736350-34736372 AGGGGCTTTGGGGAGAAAGCTGG + Intronic
906053418 1:42894118-42894140 TGGGGACTTGGGGAGAAGGGTGG - Intergenic
906178388 1:43796284-43796306 TGGGCCTCTGGCCAGAAAGCTGG - Intronic
906247787 1:44289316-44289338 TGGGTCTAAGGCCAGAAAGGGGG + Intronic
907899096 1:58721088-58721110 TGGGGCTTTAAGCAGAAGAGTGG + Intergenic
908354735 1:63318624-63318646 GGGGGTGTTGGGGAGAAAGGAGG + Intergenic
909063937 1:70910264-70910286 TGTGGCTTTAGGCAGAAACTGGG - Intronic
911115495 1:94241926-94241948 TGTGACTTTAGGCAGAAAGTTGG - Intronic
912448074 1:109752343-109752365 TGGGGCTTTCTGCAGGCAGGAGG + Intronic
912645041 1:111384320-111384342 TGAGGCTTTGGCCGGAAAGATGG - Intergenic
914402314 1:147334049-147334071 AGGGGCTTTGAGCAGAATGGTGG + Intergenic
916561040 1:165934262-165934284 TGGGGCTTTGGGGGGCTAGGAGG + Intergenic
917760858 1:178155701-178155723 GGGGGCTTTCAGCAGAACGGAGG - Intronic
917897945 1:179510900-179510922 TGGGGATTTGGGGGGAAGGGTGG - Intronic
919072926 1:192778508-192778530 TGGGGACTTGGGGAGAAGGGTGG - Intergenic
919509225 1:198439907-198439929 TGGACCTATGGGCAGAAATGGGG - Intergenic
919670048 1:200330028-200330050 TGGGGATTAGGGAAGCAAGGGGG + Intergenic
919804838 1:201375440-201375462 TGGGGGTTGGGGCAAAAAAGTGG - Intronic
921338743 1:214113177-214113199 TGGGGACTTGGGGAAAAAGGTGG - Intergenic
922345742 1:224694924-224694946 TGGGGATTTTGGGGGAAAGGTGG + Intronic
922581504 1:226701949-226701971 TGGGACTTAGGGGAGGAAGGAGG - Intronic
922726633 1:227925862-227925884 TAGGGCTGTGGGCAGGGAGGAGG + Intronic
922802709 1:228371579-228371601 GGGGGCTTTGGCCAGGAGGGTGG - Exonic
923015718 1:230125308-230125330 GGGGGCTGTGGGGAGAAAGAAGG + Intronic
923909644 1:238426870-238426892 TGGGGACTTGGGGAGAAGGGTGG - Intergenic
924306699 1:242697116-242697138 TGGAGCTTTGGACAGAAATTAGG + Intergenic
924617318 1:245622883-245622905 TGGGGCCTGGGGCAAAAAGGCGG + Intronic
1064276087 10:13906292-13906314 TGTGTCTTTGGGCAGGAAAGTGG - Intronic
1068493805 10:57758795-57758817 TGGGGATTTGGGGAAAAAGTGGG + Intergenic
1069557328 10:69406864-69406886 TGAGGATTTGGGGAGGAAGGGGG + Intronic
1069856466 10:71443656-71443678 TGGGGCTTGGGACAGAGAGAGGG + Intronic
1069916190 10:71788837-71788859 TGGGGATTGGGGCACAGAGGTGG - Intronic
1070970446 10:80562091-80562113 GGGGGCTGTGGGCAGGGAGGGGG - Intronic
1071020832 10:81053328-81053350 TGGGGGCTTGGGCGGAAGGGTGG + Intergenic
1071062960 10:81595622-81595644 TGGGGACTTGGGAGGAAAGGTGG + Intergenic
1071210056 10:83330569-83330591 TGAGGGTTTGGGCAGAAATGGGG + Intergenic
1071417914 10:85458400-85458422 TGTGACCTTGGGTAGAAAGGAGG + Intergenic
1071517167 10:86305769-86305791 TGGCCCTCTGGGGAGAAAGGAGG + Intronic
1072049433 10:91688697-91688719 TGAGGCTGTGGAGAGAAAGGGGG + Intergenic
1072801002 10:98392408-98392430 TGAGGCTGTGGGCAGGAGGGTGG - Intronic
1073516023 10:104076350-104076372 TGGGGAGTTGGGCAGAGTGGAGG + Exonic
1073585750 10:104708402-104708424 TGGGTCTCTTGGGAGAAAGGAGG - Intronic
1073731129 10:106290069-106290091 TGGGACTTTGGTGAGGAAGGGGG - Intergenic
1074420863 10:113307918-113307940 TAGGGTTTTGAGCAGAAAGCTGG - Intergenic
1075312923 10:121429871-121429893 TGGGGCTGAGGGCAGACAGGAGG - Intergenic
1075423956 10:122327443-122327465 TGGTGCCTTGGGGAGAAGGGAGG - Intronic
1075447450 10:122523522-122523544 TGGGGGTTGGGGCAGGCAGGGGG + Intergenic
1075771670 10:124943201-124943223 TGGTGCTGTGGGAAGCAAGGAGG + Exonic
1075831794 10:125418228-125418250 TGGTGCTGTGGGCAGCAAGAAGG - Intergenic
1076892748 10:133292684-133292706 GGTGGCTGTGGGGAGAAAGGAGG + Exonic
1077011692 11:381645-381667 TGGGGCCGGGGGCAGAGAGGTGG - Intronic
1077023074 11:428274-428296 TGGGGCTGTGGTCAGAGAGCAGG - Intronic
1077119698 11:901172-901194 GGGGGCCTTGGCCAGAAGGGTGG - Intronic
1077230555 11:1456581-1456603 TGGGGCCTAGGGGAGACAGGGGG - Exonic
1077298459 11:1836738-1836760 TCGGGCTGTGGGCAGCAAGAGGG - Exonic
1077333877 11:1994810-1994832 TGGGACTTTGGGGCGACAGGAGG + Intergenic
1077340501 11:2024278-2024300 AGGGGCTGTGGGCAGGAGGGAGG - Intergenic
1077342211 11:2031171-2031193 AGGGGCTCTTGGCAGATAGGTGG + Intergenic
1080968210 11:37239304-37239326 TGGGGATTTGTGAGGAAAGGAGG - Intergenic
1081701386 11:45155011-45155033 AGGAGCTTGGGGTAGAAAGGGGG + Intronic
1083803544 11:65060196-65060218 TGGGGTTGTGAGCAGGAAGGAGG - Intergenic
1084009597 11:66340206-66340228 TGGGTCTCGGGGCAGAATGGTGG - Exonic
1084088983 11:66867911-66867933 TGGGGCTGGGGGCAGAACTGGGG + Intronic
1084173700 11:67412580-67412602 TGGGACTTGGGGCAGGCAGGTGG - Intronic
1085325157 11:75601032-75601054 TGGGGCTCTGGGCAGCAGAGGGG + Intronic
1085719739 11:78902723-78902745 TAGGGCTTTGGGCATAAAGGTGG + Intronic
1086092355 11:83017536-83017558 TGGGGACTTGGGGGGAAAGGTGG - Intronic
1086402522 11:86472333-86472355 GAGGGCTTTAGGCAGGAAGGTGG + Intronic
1087679978 11:101209574-101209596 TGGGTCTTTGGGAAAAGAGGTGG + Intergenic
1088376982 11:109151902-109151924 TGGGGTCTTGGGGAGAAGGGTGG - Intergenic
1088392565 11:109330953-109330975 TGGGGGTTTGGGGATAGAGGAGG + Intergenic
1089849902 11:121487004-121487026 TGTGGGTTTGGGCACAAAGGGGG - Intronic
1090350672 11:126105858-126105880 TGGGAGTGTGGGGAGAAAGGAGG - Intergenic
1090737532 11:129623232-129623254 TGTGGCTTTGGGGACTAAGGAGG + Intergenic
1091335492 11:134762797-134762819 TGGGGCTGCAGGGAGAAAGGAGG + Intergenic
1202816860 11_KI270721v1_random:49992-50014 TGGGACTTTGGGGCGACAGGAGG + Intergenic
1202823486 11_KI270721v1_random:79467-79489 AGGGGCTGTGGGCAGGAGGGAGG - Intergenic
1202825197 11_KI270721v1_random:86360-86382 AGGGGCTCTTGGCAGATAGGTGG + Intergenic
1091999582 12:5021243-5021265 GGCGGCTTTGGGCAGACAGAGGG - Intergenic
1092319214 12:7453351-7453373 TGGGACCTTGGCCAGAAAGTGGG - Intronic
1094396223 12:30008776-30008798 TGGGGCTTTGGCCACTGAGGAGG - Intergenic
1094496131 12:30990520-30990542 TGGGGCCTCAGGCTGAAAGGCGG - Intronic
1095260523 12:40093883-40093905 AGGGGCTTTGGGCAGAGAAGTGG + Intronic
1095699289 12:45174747-45174769 TGGGGCCTTGGGCAATGAGGGGG - Intergenic
1095759863 12:45818913-45818935 TGGGGATGTGGGAAGAAAGATGG + Intronic
1096019247 12:48308345-48308367 GGGGGCGTTGGGGAGAACGGGGG + Intergenic
1096289654 12:50331029-50331051 AGGAGCTTTGGGAAGGAAGGGGG - Intronic
1096504778 12:52085876-52085898 TGGGGCCATGGGCAGACAGGCGG + Intergenic
1096670032 12:53193112-53193134 TGGAGCCTTGGGGAGAAGGGCGG - Exonic
1096777511 12:53973384-53973406 GGGGGCCTGGGGCAGGAAGGAGG - Exonic
1096984567 12:55747830-55747852 TGGTGCTTTAGGCAAATAGGAGG + Intronic
1099187271 12:79529290-79529312 GGTGGCATTGGGGAGAAAGGGGG - Intergenic
1100085686 12:90907536-90907558 TGGGGACTTGGGGGGAAAGGTGG + Intronic
1100468887 12:94873330-94873352 CGGGGCTTTGGGCAGAATTCTGG + Intergenic
1101270424 12:103137876-103137898 TGGGGGTGGGGGCATAAAGGAGG + Intergenic
1101643205 12:106603497-106603519 TGGGATTATGGGCAGAAAGGAGG - Intronic
1102680654 12:114688253-114688275 TGGGGCACTGGGCAGAAACGAGG - Intergenic
1102879059 12:116470282-116470304 TGGGGTTTGGAGCAGAAAGCAGG + Intergenic
1103188674 12:118982052-118982074 TGGGGCACAGGCCAGAAAGGAGG - Intronic
1103741264 12:123093210-123093232 TGGGGGTTTGGGGACAAATGAGG + Intronic
1103966312 12:124642057-124642079 AGGGGTGTTGGGCAGAAGGGAGG + Intergenic
1103991171 12:124800382-124800404 TGGGGCTTTTTACAGAATGGAGG - Intronic
1104396545 12:128438762-128438784 AGAGGCTTTGGGGAGACAGGAGG - Intronic
1104572439 12:129936696-129936718 TTGGTGTTTGGGGAGAAAGGAGG - Intergenic
1104734503 12:131128687-131128709 TGGGGTTTTGTGCAGATAGGGGG + Intronic
1104756725 12:131274040-131274062 AGTGGCGTTGGGCAGAGAGGAGG - Intergenic
1105600982 13:21886552-21886574 TGGGGCTTAGGGTAGAAATAAGG + Intergenic
1106582723 13:31031880-31031902 TGGGGATTTGGTAAGAAAGGAGG - Intergenic
1106694041 13:32151016-32151038 AGAGGCTTTGGGCTGGAAGGAGG + Intronic
1106829947 13:33569903-33569925 TGGGGACTTGGGGAGAAGGGTGG + Intergenic
1107110489 13:36692278-36692300 TGGGGTTTTGGTCTGAAAGAAGG + Intronic
1108355424 13:49625326-49625348 AGGGCCTTTGGGCAGAACTGGGG + Intergenic
1108502706 13:51083088-51083110 AGGGTCTTTGGGCAGAAGGAAGG - Intergenic
1110771600 13:79354860-79354882 TGGGGGTTGGGACAAAAAGGAGG + Intronic
1111308295 13:86445987-86446009 TGGAACTTGGGGCACAAAGGTGG + Intergenic
1111950826 13:94707768-94707790 TCGGGCTTTGTGCAAACAGGTGG - Intergenic
1112382818 13:98909070-98909092 GTGGGCTTTGGGCAGGAAAGTGG - Intronic
1113664902 13:112134720-112134742 TGGGGCTTTCAGGATAAAGGGGG - Intergenic
1114503251 14:23187804-23187826 TGGGACTCTGGGAAGAAAGTTGG - Intronic
1116103625 14:40472432-40472454 TAGGACTTTGGGGAGAAAGCTGG + Intergenic
1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG + Intronic
1117218217 14:53574071-53574093 TGGTGCTATTGGCAGAAAAGGGG - Intergenic
1118890057 14:69901529-69901551 TGGGGCTGTGGAAAGTAAGGGGG + Intronic
1119159958 14:72444385-72444407 TGGGGCTTGGGGGAGAACAGTGG + Intronic
1119413752 14:74455931-74455953 TGGGGCTGGGGGCAGCCAGGGGG - Intergenic
1119451209 14:74712697-74712719 TGGTGCTTTGTGCAGCTAGGTGG - Intronic
1120367639 14:83591096-83591118 TGTGGCTTTACACAGAAAGGTGG - Intergenic
1121588405 14:95079866-95079888 TGGGTCTTTTGAAAGAAAGGTGG - Intergenic
1121602997 14:95219959-95219981 TTGGGCTGTGGGAAGACAGGGGG - Intronic
1122347835 14:101071468-101071490 GGGGGCTCTGGGCAGGAAGCAGG - Intergenic
1122572004 14:102710462-102710484 TGTGGCCTTGGGTAGAAAGACGG + Intronic
1122575178 14:102737509-102737531 TGGGGCTGTGGGTGGAAAGGTGG - Intergenic
1122864548 14:104597557-104597579 GGGGCCTTTGGGAAGAGAGGAGG + Intronic
1123988240 15:25664040-25664062 TGAGGCTGTGGGCAGGAAGAGGG - Intergenic
1124396499 15:29306339-29306361 TGGGGCATTGGGGTGCAAGGCGG + Intronic
1124711601 15:32017147-32017169 TGGGGCTTTGTCCTGAAGGGAGG - Intergenic
1126679986 15:51193112-51193134 TGGGGCTTGGGGGAGGACGGTGG + Intergenic
1128009897 15:64282996-64283018 ATGGACTTTGGGCAGAAGGGTGG + Intronic
1128239941 15:66094958-66094980 TGGGGAGGAGGGCAGAAAGGTGG - Intronic
1128517153 15:68349669-68349691 TCGGGCTTTGGGCATATGGGAGG - Intronic
1129001070 15:72334500-72334522 TGGGGCTATAGGAAGAAAGGAGG - Intronic
1129096408 15:73213425-73213447 TGGGGACTTGGGGAGAATGGTGG - Intronic
1129599886 15:76992504-76992526 TGGGGAGCTGGGCAGAAGGGAGG + Intergenic
1129606300 15:77026716-77026738 TGGGGTTCTGAGCAGACAGGGGG + Intronic
1129843820 15:78759126-78759148 TGGAGTTTTGGGCAGAGGGGTGG + Intergenic
1130842026 15:87709715-87709737 TGGGGGTTTGGGCAGGTGGGAGG + Intergenic
1131013737 15:89040746-89040768 TGGGTCTGTTGGCTGAAAGGAGG + Intergenic
1131484469 15:92808742-92808764 TGGGGCTCTGGGCAGAAGCCAGG + Intronic
1131547248 15:93326200-93326222 TTGTGCTTTGGGAAGAAAGAAGG - Intergenic
1134203594 16:12219133-12219155 GGGGCCTTTTGGCAGGAAGGAGG + Intronic
1134402620 16:13924023-13924045 GTGGGCTTTGATCAGAAAGGAGG - Intronic
1134639069 16:15814654-15814676 TGAGGTTTGGGGCAGAAATGGGG - Intronic
1134781723 16:16904280-16904302 TGGGGCCTAGGGCATAGAGGTGG + Intergenic
1135789820 16:25383536-25383558 TGGGGCTTAGGGATGGAAGGAGG + Intergenic
1137600420 16:49752441-49752463 TGTTGCTATGGTCAGAAAGGGGG - Intronic
1137683696 16:50371819-50371841 AGGGGCTTGGGGCAGGAGGGAGG - Intergenic
1138267189 16:55668079-55668101 TGGGGGGCAGGGCAGAAAGGGGG - Intronic
1138871664 16:60895541-60895563 TGGGCCTCTGGCCAGAAAGATGG - Intergenic
1139974167 16:70795704-70795726 TGGGGCTTTGGGCTCTCAGGGGG + Intronic
1140062895 16:71586947-71586969 TGAGGTTTTGGGCAGAAGGGGGG + Intergenic
1140302144 16:73768291-73768313 TCGGCCTCTGGGCACAAAGGAGG + Intergenic
1143174202 17:4947448-4947470 TGGGGGCTTGGGGTGAAAGGGGG - Intronic
1143449828 17:7029461-7029483 TGGGGCCATGGGGAGAAAGAGGG - Exonic
1143530377 17:7499530-7499552 TGGGGCTCTGGGGTGCAAGGTGG + Intronic
1143584134 17:7843010-7843032 TGGGGCTTTGTGGATAAAGGTGG + Intronic
1143729749 17:8874379-8874401 TTCTGCTTTGGGCAGACAGGGGG + Intergenic
1144425140 17:15134353-15134375 TGAGTCTTTGGACAGAATGGGGG + Intergenic
1144821095 17:18075262-18075284 TGGGCCTTTGAGGAGAAAGAAGG + Intergenic
1146468937 17:33109081-33109103 TGGGGATTTGGGGAAAAGGGTGG + Intronic
1146667231 17:34713208-34713230 TGAGGCTGTGGGCAGGAAGAAGG + Intergenic
1146904162 17:36607659-36607681 CTGGGCTTTGGTCTGAAAGGGGG - Exonic
1146956953 17:36941451-36941473 TGGGCCTGTGGGCGGAAAGGAGG + Intronic
1147192568 17:38746693-38746715 TTGGGGGTTGGGCAGGAAGGGGG - Intronic
1147875641 17:43618581-43618603 CAGGGCTTTGGGCAGAAATAGGG + Intergenic
1149627508 17:58090261-58090283 TGGGGTTTGGGGTAGAAGGGAGG + Exonic
1150048744 17:61938185-61938207 TGGGGCTAGGGACAGAAAGGAGG + Intergenic
1150339860 17:64357651-64357673 TGAGGCTTAGGGCAGACAGCTGG - Intronic
1150605296 17:66685692-66685714 TGGGTCTTTGGACACAAATGAGG - Intronic
1151342148 17:73478417-73478439 TGGGGCTGGGGGCAGAAAGAGGG + Intronic
1152221006 17:79066454-79066476 TGGGGATTTGGGGGGAAGGGTGG + Intergenic
1152287900 17:79423077-79423099 TGGGGCTGGAGGCAGAAAGAGGG - Intronic
1152405667 17:80096583-80096605 TGTGGCTTGGAGCAGACAGGAGG - Intronic
1152492678 17:80648246-80648268 AGGGGGTTTGGGGAGCAAGGGGG + Intronic
1152501735 17:80715721-80715743 TGGGGACTTGGGGAGAAGGGTGG - Intronic
1152739380 17:82012348-82012370 TGAGGCCTCGGGCAGGAAGGAGG + Intronic
1152771634 17:82173125-82173147 TGGGGCTGTGGGCGGGGAGGGGG + Intronic
1153951011 18:10057668-10057690 TCTGTCTTTGGGTAGAAAGGAGG + Intergenic
1153983856 18:10335764-10335786 TGGGGGTTGGGGGAGAATGGTGG + Intergenic
1156104472 18:33641605-33641627 TGGGGCACTGGGCTAAAAGGTGG - Intronic
1156234221 18:35185412-35185434 TGGGGCATGGGGTAGGAAGGGGG + Intergenic
1156883404 18:42106990-42107012 ATGGGCTTTAGGCAGAGAGGTGG + Intergenic
1157483961 18:48073820-48073842 TAGGGCTTTGTGCAGAAACTCGG - Intronic
1158550404 18:58430996-58431018 TGGGACCTTGGGGACAAAGGTGG - Intergenic
1161587900 19:5115312-5115334 GGTGGCTCTGGGCAGAAGGGAGG + Intronic
1161983443 19:7642174-7642196 TGGGGTTTAGGGCAGGAATGAGG - Intronic
1162251673 19:9449794-9449816 TTGGACTTTGAGCAGAAACGAGG - Intergenic
1162343383 19:10105789-10105811 TGAGGCTTTGAGCGGAAAGAAGG + Intergenic
1162792409 19:13069918-13069940 TGGGATTTGGGACAGAAAGGAGG - Intronic
1163175502 19:15561785-15561807 AGGGGCTGTGGGCGGACAGGGGG - Intergenic
1163573896 19:18099315-18099337 GGGGGACTTGGGCGGAAAGGAGG + Intronic
1164836323 19:31357315-31357337 TGGGGGTTTGGGATGCAAGGGGG + Intergenic
1166369396 19:42292782-42292804 CGGGCCCTTGGGCAGAATGGTGG - Exonic
1166974992 19:46600836-46600858 TGGGGCTTTGAGGAGTAACGAGG - Exonic
1167445509 19:49534925-49534947 TGGGACTTGGGACAGAAAGGAGG - Intronic
1168707908 19:58480193-58480215 TGGGCCTCTGGGCAGCCAGGTGG - Exonic
1168713600 19:58514883-58514905 TGGGGCTTCCTGCAGGAAGGTGG - Intronic
925404464 2:3596970-3596992 TAGGCCTATGGGCACAAAGGAGG - Intronic
926277080 2:11412316-11412338 TGTGGCTTCCAGCAGAAAGGTGG - Intergenic
926410509 2:12597466-12597488 CGGAGCTTTGTGCAGAAAAGTGG - Intergenic
926701314 2:15805929-15805951 TGGGGATGTGGGAAGTAAGGGGG - Intergenic
926830651 2:16958587-16958609 TGGGGTGGTGGTCAGAAAGGTGG - Intergenic
926953632 2:18271354-18271376 TTGGGCTCTCAGCAGAAAGGAGG + Intronic
927359529 2:22216299-22216321 TAGAGCTTTGGGAAGAAAGAGGG - Intergenic
927431278 2:23028198-23028220 TGGGGCTTCCGGCAGACATGGGG + Intergenic
927435509 2:23063039-23063061 GGGGGCATTAGGCAGAAATGGGG - Intergenic
927672701 2:25082328-25082350 AGAGGCCTTGGGCAGACAGGAGG + Intronic
929789420 2:45012531-45012553 TGGGTCTTTGGACAGGAAGGAGG - Intergenic
930891096 2:56389022-56389044 TGGGGGTTTGGGGAGAAAGTGGG - Intergenic
931516874 2:63055290-63055312 AGGGGCTTTGAGCAGAAGGATGG + Intronic
931835198 2:66091794-66091816 TGGGGCCTTGGGGAAAAGGGTGG + Intergenic
931940700 2:67248672-67248694 TGAGGCTTAGGGCAGACAGAGGG + Intergenic
934763619 2:96869093-96869115 CGGGGCTCTGGGCCGACAGGGGG - Intronic
935183160 2:100707796-100707818 TGGGCCATTCGGCAGAGAGGAGG - Intergenic
935405826 2:102708000-102708022 TGGGGCTCTGGGGAGAGGGGAGG - Intronic
936284711 2:111173234-111173256 TGGGGCAGTGGGCAGGAGGGGGG - Intergenic
936856064 2:116958503-116958525 TGGGATTTTAGGCAGGAAGGGGG + Intergenic
937387885 2:121453557-121453579 TGGGGATTGGGGCAGGAATGGGG - Intronic
939954015 2:148509770-148509792 TGGTGATTTGGGAAGAAAGTTGG - Intronic
940338121 2:152549824-152549846 AGGTGCTTTGGGCAGAAGGAGGG - Intronic
941017287 2:160371826-160371848 TGGGGCTTCTGGCGGGAAGGAGG - Intronic
941029091 2:160492650-160492672 TGGTGTTTTGGGTAGAAAAGTGG - Intronic
942216380 2:173723525-173723547 TGGGTCTTTGGACAGTTAGGAGG + Intergenic
943820379 2:192314538-192314560 TGGAGCTCTTGGCAGAGAGGAGG + Intergenic
945040633 2:205741119-205741141 TGGTGCTGTGGACACAAAGGTGG + Intronic
945836312 2:214839512-214839534 TGGTACTTTGTGAAGAAAGGAGG + Intergenic
946410342 2:219512410-219512432 TGGGGCTTTGCCAAGAAAGCGGG - Intergenic
947442657 2:230136701-230136723 TGGGATTCTGGGCAGAATGGGGG + Intergenic
948164765 2:235852383-235852405 GGGGGCTTGGGGTGGAAAGGGGG + Intronic
948790257 2:240373130-240373152 TGGGGCTTTGGGCGGTGATGCGG - Intergenic
949080964 2:242099365-242099387 TGGGGCTGTGGGCCGCATGGGGG - Intergenic
1169075946 20:2759861-2759883 GGGGGCTTTGGGCATGGAGGAGG + Exonic
1169082537 20:2805957-2805979 TCGGGTGTTGGGAAGAAAGGAGG + Intergenic
1171102104 20:22394037-22394059 CTGGGCTTTGGCCAGAAATGGGG - Intergenic
1173082885 20:39886699-39886721 TGGGGCAATGGGAAGAAATGGGG - Intergenic
1173324524 20:42020425-42020447 AGGGTCTCTGGGCAGTAAGGAGG + Intergenic
1174374693 20:50118160-50118182 TGGGGTTTGGGGCAGGGAGGTGG + Intronic
1174565948 20:51464586-51464608 TGGAGCATTGGGCAGAGAGCAGG - Intronic
1175247834 20:57592131-57592153 TTGGGGTGGGGGCAGAAAGGTGG + Intergenic
1175445304 20:59015779-59015801 TGGGGCAGTTGGCAAAAAGGAGG - Intergenic
1175481689 20:59315754-59315776 TGGGGACTGGGGCAGAATGGAGG + Intronic
1175790904 20:61739285-61739307 TCAGGCTGAGGGCAGAAAGGGGG - Intronic
1177057082 21:16319346-16319368 GGAGGCTTTGGGCAGAAGAGTGG + Intergenic
1178396505 21:32248054-32248076 TGGGGCTCTCAGCAGCAAGGAGG - Intergenic
1178762561 21:35417676-35417698 TGGAGCCTTGGGTAGAGAGGTGG - Intronic
1178938951 21:36888945-36888967 TGGGGCTTTGGGCAGAAAGGAGG - Intronic
1179145153 21:38761581-38761603 TGGGGCTTTCTGCAGGAAGGTGG - Intergenic
1180194567 21:46184881-46184903 TCAGGCTTTGTGGAGAAAGGAGG + Intergenic
1181697579 22:24601677-24601699 AGGGGCCTTGGCCAGACAGGAGG - Intronic
1181985783 22:26799118-26799140 GGGGGCTCTGGGGAGAGAGGAGG - Intergenic
1183245641 22:36691288-36691310 GGGGCCTTTGGGCAGAAGGCAGG + Intronic
1183292709 22:37012569-37012591 TGGGGATTTGGGGAGCAAGGAGG - Intronic
1183382241 22:37496015-37496037 TGGGGCAGGGGGCAGCAAGGAGG + Intronic
1183458596 22:37936181-37936203 TGGGGCCTTGAGAGGAAAGGAGG + Intronic
1183508551 22:38222279-38222301 AGGGGCTCAGAGCAGAAAGGTGG + Intronic
1183587466 22:38761166-38761188 AGGGGCAGTGGGCACAAAGGAGG - Intronic
1183625612 22:38999639-38999661 GGAGGCTTTGGGCTGAAGGGTGG + Intergenic
1184450826 22:44581889-44581911 TGGGGCTGTAGTCACAAAGGAGG - Intergenic
1185050625 22:48552293-48552315 TTGGGCTCTGGGCAGGGAGGAGG + Intronic
1185295598 22:50052202-50052224 CGAGGCTTTGGGGAGAACGGTGG + Intronic
949533746 3:4979750-4979772 CGGTGCTTTGGGCAGGCAGGCGG - Exonic
950107377 3:10396834-10396856 TGGGGCTATAATCAGAAAGGGGG + Intronic
950448502 3:13052318-13052340 TGGGGCTGAGTGCAGAAAGCCGG - Intronic
951601692 3:24383390-24383412 TGGGGCTGAGGGAAGAAATGGGG + Intronic
953473510 3:43186191-43186213 TGGATCTTGGGGCAGGAAGGTGG - Intergenic
953918563 3:46936419-46936441 TGGGGCTCTGGGCAGAAGGAAGG - Intronic
954141406 3:48608594-48608616 TGGGGCTGGGGGCTGAAAGGAGG + Intronic
954147678 3:48642328-48642350 TGGGGCCTGGGGCAGGGAGGAGG - Intronic
954436221 3:50497760-50497782 TGTGGCTAAGGGCAGAAGGGGGG - Intronic
955044880 3:55350413-55350435 AGGGGTTTTGGTCAGTAAGGGGG - Intergenic
955374926 3:58386857-58386879 TGGGGCTTTAGGCCTAAAAGGGG - Intronic
955615029 3:60798576-60798598 TGGGGCCCAGGGCAAAAAGGAGG - Intronic
955845379 3:63157024-63157046 GGGGGCTTAGGGGAGAGAGGAGG + Intergenic
955948574 3:64219405-64219427 TGTGGCTGTGGGCAGAGAGATGG - Intronic
956836572 3:73100751-73100773 TGAGGCTTGAGGCAGAAAGCTGG - Intergenic
957528000 3:81402460-81402482 TGGGGAGTTGAGAAGAAAGGGGG - Intergenic
958644257 3:96849316-96849338 TGGGAGTTTGGGCAGTAAGATGG + Intronic
959081067 3:101801606-101801628 TGGGGCTGTGGGCAGGGTGGTGG + Exonic
959745543 3:109772326-109772348 TGGGGACTTGGGGGGAAAGGTGG + Intergenic
959802071 3:110506954-110506976 TGGGGAATTGGGCAGAAGGGTGG - Intergenic
961423845 3:126829586-126829608 TGGGGCTTTGGGAAGTCATGAGG + Intronic
962597161 3:136957917-136957939 TCTGGGTTTGGGCAGAAAGGAGG + Exonic
962928821 3:140019113-140019135 TGGGGCTTTGGGGAGCAAGGAGG - Intronic
964383830 3:156126276-156126298 TGGGGAGTTGGGCAGAGAGCAGG + Intronic
965047163 3:163593965-163593987 TGGGGCTATGGGCTCAATGGGGG - Intergenic
967035441 3:185645705-185645727 TGGGGCTTGGGGATGAAGGGTGG + Intronic
967947842 3:194818303-194818325 AGGGTCTTTGGGCAGCACGGAGG - Intergenic
968882347 4:3307873-3307895 TGGAACTTTGGGAAGAAAGAAGG - Intronic
968887402 4:3341798-3341820 TGGGGGTGTGGACAGAAGGGAGG + Intronic
969527258 4:7710201-7710223 TGAGGCTTTGCGCAGAAACATGG - Intronic
969659537 4:8518410-8518432 TGGGCATTAGGGCAGAAGGGAGG + Intergenic
970818238 4:20183283-20183305 TGGGGATTTGTGCAGAAGGGTGG - Intergenic
972645281 4:40962164-40962186 AGGGGCTATTGACAGAAAGGAGG + Intronic
974909531 4:68100076-68100098 TGGGGCGTTGGGGGGAAGGGAGG + Intronic
976455106 4:85237341-85237363 TGGGGACTTGGGGAGAAGGGTGG - Intergenic
976810970 4:89100913-89100935 TGTGGCTTTGGGGACAAAGTAGG + Intronic
977992976 4:103466871-103466893 TGGAGGTTTGAGCAGAAAGAAGG + Intergenic
978387451 4:108190377-108190399 TGGGGCTTAGGAGAGAAATGTGG - Intergenic
978880325 4:113694599-113694621 TGGGGTATTGGACAGATAGGAGG + Intronic
980115855 4:128678466-128678488 TGGGGCTTTTGGAAGGGAGGTGG - Intergenic
980613251 4:135185007-135185029 TGGGGGTCGGGGCAGAAAGGAGG + Intergenic
981562759 4:146065539-146065561 TAGAGCTTTGCCCAGAAAGGAGG + Intergenic
981575352 4:146198436-146198458 TGGGAATTTGGGAAAAAAGGTGG + Intronic
981887176 4:149690410-149690432 TGGGGACTTGGGGGGAAAGGTGG + Intergenic
984583312 4:181534927-181534949 GGAGGCTGTGGCCAGAAAGGAGG + Intergenic
986671120 5:10143903-10143925 TGTGGCTTTGGGAAGACTGGAGG - Intergenic
986805262 5:11302922-11302944 TGGGGCAGTAGGCAAAAAGGAGG - Intronic
988466441 5:31496673-31496695 TGGGGCTGTGGGCATAGAGCAGG - Intronic
989371909 5:40719214-40719236 TGGGGTTTTGGGGAGAAATGAGG - Intronic
990442283 5:55858961-55858983 TGGGGCATGGGGCACAAAGGAGG + Intronic
991975131 5:72177646-72177668 TGTGGGTTTCTGCAGAAAGGAGG + Intronic
992451238 5:76878263-76878285 AGGGTCTATGAGCAGAAAGGCGG + Intronic
995852967 5:116565751-116565773 TGGCTCTCTGGGTAGAAAGGAGG + Intronic
996263577 5:121505905-121505927 TGGGGCCTTGGGGGAAAAGGTGG + Intergenic
996443132 5:123512998-123513020 AGGGGCTTCAGGCAGGAAGGAGG + Intronic
997346248 5:133194598-133194620 TGGAGCTGTGGGCAGCAAGTGGG - Intergenic
997509265 5:134442137-134442159 AGGGGCTGGGGGCAGGAAGGGGG + Intergenic
997602959 5:135152786-135152808 AGAGGCTTAGGGAAGAAAGGAGG + Intronic
998138380 5:139686335-139686357 TGAGGCTTTGTGCAGTAATGTGG + Intergenic
999071780 5:148750771-148750793 TGTGGGTTGGGGCAGGAAGGGGG - Intergenic
1000471323 5:161645804-161645826 TGGGGACTTGGACAGAATGGTGG - Intronic
1000641635 5:163709854-163709876 TGGGGCTTTGGGCTGGAGAGAGG + Intergenic
1001088858 5:168722157-168722179 GTGGGCTTTGGGCAGAGAGTGGG + Intronic
1001910945 5:175517376-175517398 TGGGGCGTGGGGCAGGTAGGGGG - Intronic
1002194897 5:177496451-177496473 TGGGGCTTCCGGCTGCAAGGGGG - Exonic
1003277154 6:4662583-4662605 TGGGGCGTTGGGCTGGATGGAGG + Intergenic
1003277734 6:4666769-4666791 TGGAGGTTAGGGCAGAAAGAAGG - Intergenic
1003954082 6:11146069-11146091 TGATGCTTTGAGCAGTAAGGTGG + Intergenic
1006176632 6:32126270-32126292 TGGGGCAGGGGGCAGAAAGAAGG + Intronic
1006393392 6:33771962-33771984 TGGGGCTGAGAGCAGAGAGGAGG - Exonic
1007095163 6:39208428-39208450 GGGGGCTTTGAGAAGAAAGATGG - Intronic
1007389249 6:41540908-41540930 TGGGACTTTGGGCTGATTGGTGG - Intergenic
1007424677 6:41739334-41739356 TGGGGCTGTGTGCAGGATGGGGG - Intronic
1007967133 6:46013938-46013960 TGGACCTTAGGGCAGCAAGGGGG - Intronic
1008547492 6:52596031-52596053 TGGGGCTATGGGCATCTAGGGGG + Intergenic
1009192782 6:60649804-60649826 TGGGGCTTCGGGCAGTAGGGAGG + Intergenic
1010390531 6:75331894-75331916 TGGTGATTAGGTCAGAAAGGTGG + Intronic
1010439439 6:75876283-75876305 TGGGGCTTATGGAATAAAGGAGG - Intronic
1011488645 6:87868862-87868884 TGGTGGTTTGGGGAGAAAGTGGG - Intergenic
1012276767 6:97283359-97283381 TGGTGCGTTCGGCTGAAAGGCGG + Intergenic
1014244534 6:119053523-119053545 TTGGTCATTGGGCAGAAAAGTGG - Intronic
1014756145 6:125303466-125303488 TAGGCCTCTGGGAAGAAAGGAGG + Intergenic
1016611697 6:145997658-145997680 TGGGACTTTTGGGAGAAAAGAGG + Intergenic
1017912462 6:158805864-158805886 TGGGGCTGTGGGCAGGGATGGGG - Intronic
1018223919 6:161609587-161609609 TGGGGCTTCGGGCAGATGGTTGG + Intronic
1018397043 6:163386171-163386193 TGTGGCTTTAGGGAGAAAAGAGG - Intergenic
1018524560 6:164694424-164694446 TGGAACTTTGGGCAAAAAAGTGG - Intergenic
1019336318 7:484661-484683 TTGGGCTTGGGGCAGGCAGGGGG + Intergenic
1019843839 7:3476878-3476900 TAGGGCTTTTGGCAGTAAGTGGG + Intronic
1020792290 7:12641807-12641829 TGGGGATCTGGGGAGAAAGGAGG - Intronic
1022359342 7:29643608-29643630 TGAGGGTTTGGGCAGAAGTGCGG + Intergenic
1022400149 7:30028707-30028729 TGGGGCCTGGGGCAGTGAGGGGG + Exonic
1023291122 7:38670110-38670132 TGGGACTTGGGACAGAGAGGAGG + Intergenic
1023388363 7:39682984-39683006 TGGGGCTTTGGGAAGTAATTAGG + Intronic
1023560971 7:41472945-41472967 TGGGCCTGTGGGCAGACAGAGGG + Intergenic
1026287339 7:68974939-68974961 TGAGTCTTTGGGCAGCAACGAGG - Intergenic
1026742888 7:72990175-72990197 TGGGGCCTGGGGTGGAAAGGGGG - Intergenic
1026802744 7:73410565-73410587 TGGGGCCTGGGGTGGAAAGGGGG - Intergenic
1027100847 7:75374903-75374925 TGGGGCCTGGGGTGGAAAGGGGG + Intergenic
1027176413 7:75906592-75906614 AGGGGTTTGGGGCAGCAAGGAGG + Intronic
1027238270 7:76310933-76310955 TGGGGCGGTGGGCAGGGAGGGGG - Intergenic
1027544818 7:79514075-79514097 TGTGGATGTGGGCAGAAAGTAGG + Intergenic
1028442144 7:90876068-90876090 TGAGGCTTTGGCCAGATAGCTGG + Intronic
1028819049 7:95184621-95184643 TGGGGACTTGGGAGGAAAGGTGG - Intronic
1029109748 7:98206940-98206962 TGGGGCTTAATGCAGAACGGAGG - Exonic
1030389963 7:108915506-108915528 TGGGGATTTGGGAGGAAGGGTGG - Intergenic
1030821677 7:114099767-114099789 TGGGGCTTGGGGAGGAAATGGGG + Intronic
1030891378 7:115003283-115003305 TGGGGCTGGGGGGTGAAAGGTGG - Intronic
1030891754 7:115007474-115007496 TCAGTTTTTGGGCAGAAAGGAGG - Intronic
1032082465 7:128866570-128866592 TGGGGCTTTGGGGTGCAGGGTGG - Intronic
1032325229 7:130921819-130921841 TGGAGCTTTAGGCGTAAAGGCGG + Intergenic
1034200424 7:149280340-149280362 TGGGGCCTGGGGAAGAAGGGCGG + Intronic
1034966035 7:155391605-155391627 CGGGGCCCTGGGCAGCAAGGAGG - Intronic
1035538865 8:416171-416193 TGGGGCTGTGGGCCGCATGGGGG - Intronic
1036647717 8:10622644-10622666 TGAGGCTTTGCCGAGAAAGGCGG + Exonic
1036683146 8:10890807-10890829 TTGCGCTTTGGGCAGACAAGAGG - Intergenic
1036788170 8:11701680-11701702 TGAGGCCTTGGGGAGAAAGTTGG + Intronic
1037228811 8:16629123-16629145 TGGGGGTTGGGGGAGAAAGTGGG + Intergenic
1037564336 8:20104867-20104889 TGGGGAATTGGTCAGTAAGGAGG - Intergenic
1038159502 8:25023263-25023285 TGGTGCTCTGAGGAGAAAGGAGG - Intergenic
1038172889 8:25154112-25154134 TGGGGACTTGGGGAGAAAGGTGG - Intergenic
1040820809 8:51554748-51554770 TGGGGTCTTGGACAGAAATGAGG - Intronic
1040896379 8:52373249-52373271 GGGGGCTTTGGGGAGGAGGGAGG - Intronic
1041152107 8:54945254-54945276 AGGGTCTTAGGGCAGATAGGTGG - Intergenic
1041633344 8:60113816-60113838 TGGGGCATTGGGCCTAAAGGAGG - Intergenic
1042145355 8:65722603-65722625 TTGGGCTTTGGGTATAAAGGAGG - Intronic
1042840256 8:73116609-73116631 TGGGGTGATGGGCAGGAAGGAGG + Intronic
1042955437 8:74244986-74245008 AGGGGCTTTGGGGAGGAAGCAGG + Exonic
1044902356 8:96960638-96960660 TGGGGGTTAGGGCAGAGAGGAGG - Intronic
1046456681 8:114474170-114474192 TGGGGCATAGGGCAGGAGGGAGG - Intergenic
1047521250 8:125596971-125596993 CGGGGGTGTGAGCAGAAAGGAGG - Intergenic
1047764809 8:127981743-127981765 TGGGGGTGTGGGAAGAAAGGAGG - Intergenic
1048346969 8:133583299-133583321 TTGGGCTTTTTGCAGCAAGGGGG + Intergenic
1048815936 8:138333649-138333671 TGGGATTTTGGACAGAAAGAAGG - Intronic
1048890243 8:138940522-138940544 TGGGGGGGTGGGGAGAAAGGTGG - Intergenic
1049363916 8:142227303-142227325 TGGAGTTGTGGGCAGGAAGGGGG - Intronic
1049363926 8:142227339-142227361 TGGGGCTATGGGCAGGATGGGGG - Intronic
1049363938 8:142227375-142227397 TGGGGCTATTGGCAGGATGGGGG - Intronic
1049363970 8:142227483-142227505 TGGGGTTATGGGCAGGAATGGGG - Intronic
1049363982 8:142227519-142227541 TGGGGTTGTGGGCAGAATGGGGG - Intronic
1049622147 8:143603298-143603320 TGGGGCATAGGGCATAAAAGTGG + Intergenic
1049765520 8:144353616-144353638 CGGGGCTTCGGGCAGGACGGGGG - Intronic
1053665435 9:40314266-40314288 TAGGGGTTTGGGGAGAATGGGGG + Intronic
1053915026 9:42939313-42939335 TAGGGGTTTGGGGAGAATGGGGG + Intergenic
1054376588 9:64454296-64454318 TAGGGGTTTGGGGAGAATGGGGG + Intergenic
1054519180 9:66062018-66062040 TAGGGGTTTGGGGAGAATGGGGG - Intergenic
1054916347 9:70498357-70498379 TGGGGCATTGGGCAGCATGGGGG - Intergenic
1056589900 9:87958477-87958499 TGGCGCTTTGGGAGGCAAGGTGG - Intergenic
1056673826 9:88655953-88655975 TGGGGATTTGGAGAGAAAGGTGG + Intergenic
1056811171 9:89765230-89765252 TGGGGCTAGGGGCAGAAGTGGGG - Intergenic
1057802510 9:98198740-98198762 ATGGGCTGTGAGCAGAAAGGAGG + Intergenic
1057928119 9:99170767-99170789 TGGGGGTGCGGGTAGAAAGGGGG + Intergenic
1058771248 9:108234518-108234540 TGGGGACTTGGGAGGAAAGGTGG + Intergenic
1061359283 9:130131002-130131024 TGGGGCTTTGCAAGGAAAGGGGG + Intronic
1061479165 9:130888096-130888118 GGGGGCTTAGGGCGGAAAGGTGG - Intergenic
1061992446 9:134166811-134166833 TGGCGCCTGGGGCAGAAAGGTGG + Intergenic
1062179580 9:135184070-135184092 AGGGGCTGTGAGCAGAAGGGAGG + Intergenic
1185449541 X:275155-275177 GGGGGCTTTGGGCAGAGAGGGGG + Intergenic
1185456692 X:314306-314328 TGGGCCTCTGGGCCGAAGGGAGG + Intronic
1185582964 X:1225242-1225264 TGGGGCATTGGGGACAATGGAGG - Intergenic
1185773256 X:2782086-2782108 TCGGGCTGTGGGTAGTAAGGTGG - Exonic
1186228968 X:7432008-7432030 TGGGGCTTTGGGAGGTAATGAGG + Intergenic
1188045396 X:25420506-25420528 TGGGGACTTGGGCAGAAGAGTGG - Intergenic
1189281453 X:39822072-39822094 TGGGGCGCTTGGCAGAAACGCGG - Intergenic
1189363121 X:40368673-40368695 GGGGGATTTGATCAGAAAGGAGG + Intergenic
1189736347 X:44073487-44073509 TGGGGCTATGGGAAAAGAGGGGG + Intergenic
1189785941 X:44558906-44558928 TGGTACTTGGGGCAGAGAGGTGG - Intergenic
1190286707 X:48966301-48966323 TGGCACTATGGGCAGAAGGGAGG + Exonic
1190436806 X:50433598-50433620 TGGGGGTTTGAGGAGAAAAGTGG + Intronic
1190929277 X:54934420-54934442 TGGGGCTTGGGGCTGACAGAGGG + Intronic
1191883217 X:65863019-65863041 TGGGGTCTTGGGCTAAAAGGTGG + Intergenic
1194483528 X:94457152-94457174 TGGGGTTTGGCCCAGAAAGGTGG + Intergenic
1195009370 X:100720253-100720275 AGGGGCTTTTGGCAGAGAAGAGG - Intronic
1195556984 X:106238071-106238093 TGGGGACTTGGGGAGAAGGGTGG + Intergenic
1196532108 X:116799977-116799999 TGGGGGTTTGGGAGGAAATGGGG - Intergenic
1198782017 X:140248026-140248048 TGGGGCTTGTGGCAAAATGGAGG + Intergenic
1200009425 X:153109919-153109941 AGGGGTATAGGGCAGAAAGGGGG - Intergenic
1200030175 X:153290003-153290025 AGGGGTATAGGGCAGAAAGGGGG + Intergenic
1200076712 X:153554807-153554829 TGGGGCCTTGGGGAGAAGGCAGG + Intronic
1200325244 X:155231132-155231154 TGGGGTCTTGAGCAGAAAAGCGG - Intronic