ID: 1178938992

View in Genome Browser
Species Human (GRCh38)
Location 21:36889320-36889342
Sequence CGCAGTGTGTGGTGAGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 234}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178938992_1178938996 12 Left 1178938992 21:36889320-36889342 CCATCTGCTCACCACACACTGCG 0: 1
1: 0
2: 2
3: 23
4: 234
Right 1178938996 21:36889355-36889377 TTCACTCTCTGATGGAGACTTGG 0: 1
1: 0
2: 2
3: 39
4: 332
1178938992_1178938995 4 Left 1178938992 21:36889320-36889342 CCATCTGCTCACCACACACTGCG 0: 1
1: 0
2: 2
3: 23
4: 234
Right 1178938995 21:36889347-36889369 CACGTCATTTCACTCTCTGATGG 0: 1
1: 0
2: 0
3: 12
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178938992 Original CRISPR CGCAGTGTGTGGTGAGCAGA TGG (reversed) Intronic
900093211 1:929561-929583 GGCAGGGTGTGGTGGGCAGAAGG + Intronic
900142560 1:1144798-1144820 CGTGGTGTGTGCTGTGCAGACGG + Intergenic
900689890 1:3974136-3974158 CCCCGTGTGCAGTGAGCAGATGG + Intergenic
901900329 1:12356018-12356040 CGGATTGTGTGTCGAGCAGAAGG + Exonic
902614606 1:17616970-17616992 CGCCTTGTGTGGTGAGGATAAGG - Intronic
902727986 1:18350068-18350090 AGCAGTGGGTGGTGAGGAAAGGG + Intronic
903189679 1:21649749-21649771 CGGAGTGTGTGGTGAGTACTGGG - Exonic
903594546 1:24484260-24484282 GGCAGTGGGAGGTGAGCAGCAGG - Intergenic
904326359 1:29729124-29729146 TGCCGTGTGTGGTGGGCAGGAGG - Intergenic
904775381 1:32902794-32902816 CGCTGTGTGTGTTGGGCAGTTGG + Intergenic
906155046 1:43609152-43609174 AGGAGTGTGGCGTGAGCAGAGGG - Intronic
906436681 1:45802697-45802719 CACAGTGTGTGGTATGCAGTGGG + Intronic
906812251 1:48839823-48839845 CCCAGTGTGTGGTGGACAGAGGG + Intronic
908098200 1:60762814-60762836 GGCTGTGTGTGGTGGGAAGAGGG + Intergenic
909423049 1:75487855-75487877 CACAGTGAGGGGTGAGCAGCAGG + Intronic
910736667 1:90465831-90465853 CTCAGTGTGTGGGGAGAAGGAGG - Intergenic
913547951 1:119887976-119887998 CTCACTCTGTGCTGAGCAGAGGG - Intergenic
913958995 1:143324735-143324757 CGCAGTGTGGGGTGGGTTGAGGG - Intergenic
914053312 1:144150115-144150137 CGCAGTGTGGGGTGGGTTGAGGG - Intergenic
914125885 1:144816426-144816448 CGCAGTGTGGGGTGGGTTGAGGG + Intergenic
915111338 1:153566259-153566281 CACAGTCTGTGGGGAGCATAAGG + Intronic
915635772 1:157185524-157185546 TGCTGTGTGTGGTGAGCAGGTGG - Intergenic
915648314 1:157289600-157289622 TGCTGTGTGTGGTGAGCACGTGG + Intergenic
918301902 1:183212316-183212338 CTCTGTGAGTGGTCAGCAGAAGG - Intronic
918596587 1:186301230-186301252 AGCAGTGTGTGAAGAGGAGAAGG + Intronic
920060014 1:203220859-203220881 CACACTGTGTGGTGAGTAGAAGG + Intronic
921076233 1:211702246-211702268 GGTAGAGTGAGGTGAGCAGAGGG + Intergenic
921159188 1:212461093-212461115 AGCGTTGTGTGGTGAGCATAGGG - Intergenic
923335951 1:232970360-232970382 CCTAGTGTCTGGTGAGGAGATGG - Intronic
1067698645 10:48553108-48553130 CCCAGTGGGAGGGGAGCAGAGGG + Intronic
1068351069 10:55845914-55845936 GGCAGTGTGTGGGGGGCAGCAGG - Intergenic
1072685331 10:97533279-97533301 AGCAGTGGGTGGGGAGGAGAAGG - Intronic
1073682520 10:105719605-105719627 CGCAGTAGGAGGTGAGCAGCAGG - Intergenic
1076199304 10:128545835-128545857 TGCGGTGTGTGGAGAGCAAATGG - Intergenic
1076500786 10:130934445-130934467 AGCAGTGGGTGGTCACCAGATGG + Intergenic
1077185705 11:1234522-1234544 CGCAGTGTGTGCTGAACTGTGGG - Exonic
1077445316 11:2588012-2588034 CGCAGTGGGTGGTGAGCAGTGGG + Intronic
1077577334 11:3394471-3394493 AGGAGAGTGTGGTGGGCAGATGG - Intergenic
1079225472 11:18601009-18601031 CACTCTGTGTGGTGACCAGAAGG - Intergenic
1083784269 11:64934839-64934861 TGCAGTGTGTGGGGAGCCGGAGG - Exonic
1084019328 11:66408669-66408691 CGCAGGCTTTGGGGAGCAGAGGG + Intergenic
1084481987 11:69427292-69427314 CTCAGTTTGGGGTCAGCAGAGGG + Intergenic
1085710962 11:78828983-78829005 CCCACTGGGTGGAGAGCAGATGG - Intronic
1086215175 11:84370560-84370582 CACAGTGTGTGGTGTACAGTAGG + Intronic
1086286931 11:85261788-85261810 CCTAGTGTGTGATGAGGAGAAGG + Intronic
1087343794 11:96943067-96943089 CGCAGTAGGAGGTGAGCAGTGGG - Intergenic
1088402985 11:109441595-109441617 TGGAGTGTGTTGTGAACAGAAGG - Intergenic
1090445633 11:126762513-126762535 GGCAATGGGAGGTGAGCAGAAGG + Intronic
1090898505 11:131003529-131003551 AGCAGTGAGTAGTGAGCAAATGG - Intergenic
1092534436 12:9375089-9375111 CTCGGTTTGTGGGGAGCAGAGGG + Intergenic
1101957338 12:109222936-109222958 CACAGTGTGTGCTCTGCAGATGG - Intronic
1102623167 12:114213146-114213168 TGCAGAGTGTGGTCAGCAGGTGG - Intergenic
1103202136 12:119096492-119096514 CTCAGTGTCTGGTGTGCAGGAGG + Intronic
1104462030 12:128963833-128963855 GGCTGTGGGTGGTGCGCAGATGG + Intronic
1104739896 12:131164684-131164706 CGCAGTGTCTGGTGAGCCTGAGG - Intergenic
1104947011 12:132419808-132419830 CGGAGTGTGTGGGCGGCAGAGGG - Intergenic
1105579545 13:21681867-21681889 CACAGTGTGTGGTACGCAGCAGG + Intronic
1105819362 13:24066204-24066226 GGCATTTTGGGGTGAGCAGATGG - Intronic
1106023975 13:25940198-25940220 CACTCTCTGTGGTGAGCAGAAGG - Intronic
1112660045 13:101497431-101497453 CGGACTGTGGGGTGAGTAGAAGG - Intronic
1112897096 13:104313066-104313088 CAGACTGTGTGGTGATCAGATGG + Intergenic
1113443495 13:110347633-110347655 TGCAGTGTGTGGTGGGCCAAAGG - Intronic
1113794262 13:113047842-113047864 CGTAGTGAGGCGTGAGCAGAGGG - Intronic
1113968227 13:114166844-114166866 CGCAGCCCGTGGTGAGGAGAGGG - Intergenic
1116863218 14:50010894-50010916 TGCAGTGTGGGGAGAGAAGAGGG - Intergenic
1118493422 14:66284472-66284494 AGCAGGGTCTGATGAGCAGAAGG - Intergenic
1119407268 14:74406661-74406683 CTCAGTGGCTGGTGAGCTGAGGG + Exonic
1119772005 14:77225879-77225901 CTCAGTGCCTGGAGAGCAGAGGG + Intronic
1125335107 15:38619214-38619236 GGCAGAGGGTGGAGAGCAGACGG + Intergenic
1125710719 15:41783624-41783646 CTCAGTTTGTCCTGAGCAGAGGG + Intronic
1125755933 15:42065101-42065123 CACAGCCTGTGGTGAGCAGAGGG + Intergenic
1127282929 15:57507251-57507273 TGCAGTGTGTTGTGGTCAGAAGG + Intronic
1127289000 15:57553944-57553966 CGCAGTGTGTGGTGGGCTGGAGG + Intergenic
1127809494 15:62551232-62551254 CACAGTAGGTGGTGAGCAGTGGG - Intronic
1128570374 15:68729283-68729305 CGCAGTGTGTAATGGGCAGAGGG - Intergenic
1130298730 15:82664823-82664845 CGCAGACAGTGGTGAGCAGATGG - Exonic
1132502025 16:288701-288723 AGCACTGGGCGGTGAGCAGAGGG - Intronic
1135172011 16:20193013-20193035 CCCAGTGTATGCTGAGCACAAGG - Intergenic
1137524927 16:49226623-49226645 CTCAGGGGGTGTTGAGCAGAAGG - Intergenic
1142287743 16:89178292-89178314 GGCAGAGTGTGGGGTGCAGAGGG - Intronic
1144171173 17:12661387-12661409 GGGATAGTGTGGTGAGCAGAGGG - Intergenic
1145052153 17:19671029-19671051 AGCAGTGTGAGCTGGGCAGAGGG - Intronic
1147689904 17:42308660-42308682 AGCAGGGTGTGGAGAGCAGCTGG - Intronic
1150893469 17:69182674-69182696 CATAGTGTCTGGTGACCAGAAGG - Exonic
1151725623 17:75882102-75882124 GGCTGTGGGTGGGGAGCAGAGGG - Intronic
1156253352 18:35373392-35373414 AGATGTGTGTGGTGAGCAGAGGG + Intronic
1157214830 18:45774180-45774202 GACAGGATGTGGTGAGCAGAGGG - Intergenic
1159040492 18:63319745-63319767 CGCTGTGTGTGGTGCGGCGAGGG + Exonic
1160618139 18:80149364-80149386 CCCTGGGTGTGGTCAGCAGACGG + Intronic
1161234475 19:3191001-3191023 CGCGGTGTGTGGCGGGCAGCAGG + Intronic
1161234487 19:3191063-3191085 CGCGGTGTGTGGCGGGCAGCAGG + Intronic
1161325451 19:3661542-3661564 GGCGGTGTGGGGTGACCAGAAGG + Intronic
1164051248 19:21586983-21587005 CGCAGTGGCTGGTGGGCAGTGGG + Intergenic
1164790172 19:30970740-30970762 CCCAGTGTGTGGTCTGCAGTTGG - Intergenic
1164816607 19:31209002-31209024 TGAGGTGTGTGATGAGCAGAAGG + Intergenic
1166077188 19:40420711-40420733 CGCAGAGTGTTGTAAACAGAGGG + Intergenic
1167281078 19:48568907-48568929 AGCGGTGTGTGGGGACCAGAAGG - Intronic
1167539459 19:50075811-50075833 CGCAGGGTGTGGCGAACAGAAGG - Intergenic
1168050166 19:53823982-53824004 CGAAGTGGGTGATGAGCAGCTGG + Exonic
1202692710 1_KI270712v1_random:102538-102560 CGCAGTGTGGGGTGGGTTGAGGG - Intergenic
925105048 2:1283633-1283655 CACAGGCTGTGGTGAGGAGAGGG - Intronic
925383899 2:3448576-3448598 CGCAGGGCGTGGAGAGCAGCCGG + Intronic
925681292 2:6424509-6424531 AGCAGTGTGTGGGGAGAAAAAGG - Intergenic
929223678 2:39490781-39490803 CCCAGGGTGTGGTGTGCAGTTGG + Intergenic
929397560 2:41540738-41540760 CCCAGTGTGTACAGAGCAGAAGG + Intergenic
929446327 2:42004115-42004137 CTTTGTGTGTGGTGAGCAGCAGG - Intergenic
931882926 2:66585691-66585713 CCCAGTGTCTGGTGTCCAGAAGG - Intergenic
932231100 2:70085319-70085341 TGCAGTGTCTGGTGAGGATAGGG - Intergenic
933297687 2:80509035-80509057 AGCAATGTGTGGTAAACAGAAGG + Intronic
933953692 2:87351426-87351448 CGCAGTGTGGGGTGGGTTGAGGG + Intergenic
934237897 2:90247680-90247702 CGCAGTGTGGGGTGGGTTGAGGG + Intergenic
936057621 2:109272699-109272721 GGCTGTGTGTGGTCAGCAGAGGG + Intronic
936789433 2:116133740-116133762 CGTGGTGTGCGGTGAGCAGCCGG - Intergenic
938792354 2:134688105-134688127 AGCAGTGTCTGGTGCGCAGTGGG - Intronic
944217925 2:197274389-197274411 TGCAGAGTGTGGTCAGCACATGG + Intronic
945198349 2:207257904-207257926 GGCAGGGTCTGGTGACCAGATGG - Intergenic
946182995 2:217960132-217960154 CCCAGTGAGTGGGGGGCAGAAGG + Intronic
946474641 2:219995675-219995697 CTGCGTGTGTGGTGTGCAGAGGG + Intergenic
948111000 2:235455867-235455889 CGAAGTCTCTGATGAGCAGATGG + Intergenic
948229828 2:236341744-236341766 TGCTGTGTGTGGTGGGGAGAAGG + Intronic
948272658 2:236686432-236686454 TGCAGTGTGTGAGGAACAGAGGG - Intergenic
948433493 2:237935995-237936017 AGCAGGGTGGGGTCAGCAGATGG - Intergenic
948853344 2:240718887-240718909 CGGAGTCTGGGGTGAGCAGATGG + Intronic
1169100017 20:2939466-2939488 CACAGTGTCTGGTGAGGAAAAGG + Intronic
1172014312 20:31863835-31863857 GGGAGTGTGTGTTCAGCAGAGGG + Intronic
1174082746 20:47982820-47982842 CGCAGTGGGTGGTGGGCAGGGGG - Intergenic
1174285679 20:49471313-49471335 TGCTGTGTGTGGAGACCAGACGG + Intronic
1175138118 20:56840138-56840160 GGCAGTGTGTGGGGAGCTCAGGG + Intergenic
1177584324 21:23070093-23070115 TGCAGTGCTTGGTGACCAGAAGG - Intergenic
1177971999 21:27801549-27801571 TGCAGTTTGTGGTGAGCAAGGGG + Intergenic
1178904981 21:36629300-36629322 CGCAGGGCATGGTTAGCAGATGG - Intergenic
1178938992 21:36889320-36889342 CGCAGTGTGTGGTGAGCAGATGG - Intronic
1179328897 21:40379304-40379326 GTCAGTGGGTGGTGAGCATATGG + Intronic
1179730067 21:43362663-43362685 TGCAGTGCGTGGAGTGCAGAAGG - Intergenic
1180002041 21:44999562-44999584 CCCAGTACCTGGTGAGCAGAGGG - Intergenic
1180248248 21:46562659-46562681 GGCTGAGTGTGGGGAGCAGAAGG + Intronic
1182550923 22:31100373-31100395 CTGAGGGTGAGGTGAGCAGACGG - Intronic
1183544950 22:38450500-38450522 CGCAGGGAGAGGGGAGCAGAAGG - Intronic
1183981006 22:41540204-41540226 CGCTGCCTGTGGAGAGCAGACGG - Intronic
1184309764 22:43633716-43633738 CCCACGGTGTGGTGGGCAGATGG + Intronic
1184479067 22:44736688-44736710 CCCAGTGTGCAGTGAGCAGCAGG + Intronic
1184839315 22:47043313-47043335 CGAAGGGTGTGGGGAGCAGCAGG + Intronic
1184884930 22:47337539-47337561 AGCACTGTGTGGTGAGGAGGTGG - Intergenic
1185088448 22:48753121-48753143 CTCAGTGCATGGGGAGCAGAGGG - Intronic
1185338807 22:50282665-50282687 AGCTGGGTGTGGGGAGCAGAGGG + Intronic
952943379 3:38459710-38459732 CTCAGGGTGTGGTGGCCAGATGG + Intronic
954381636 3:50221968-50221990 CGCAGTGTGTTCTGATGAGAGGG + Intergenic
955035919 3:55267667-55267689 TGCAGTGTGTGATGAAGAGAGGG - Intergenic
955976589 3:64485954-64485976 GCCAGTGAGTGGTTAGCAGAGGG - Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957043022 3:75351475-75351497 AGGAGAGTGTGGTGGGCAGATGG - Intergenic
957121814 3:76103455-76103477 AGCTGTGTATTGTGAGCAGAGGG - Intronic
957163062 3:76635025-76635047 CACAGTGGGTTGGGAGCAGATGG - Intronic
960155682 3:114295237-114295259 GGCAGTGGGTGGGGAGGAGATGG + Intronic
961080658 3:124024551-124024573 GCCAGTGTGTGGTGAGGGGATGG - Intergenic
961130962 3:124467199-124467221 AGCAGTGAGGGGTGAGCAGCAGG + Intronic
962482481 3:135809707-135809729 CTCAGTGTGTTCCGAGCAGAAGG + Intergenic
962866768 3:139453618-139453640 CGCAGGGTGTGAGGTGCAGAAGG + Intronic
963055384 3:141182236-141182258 TGCAGGGTGTGTTGACCAGAAGG - Intergenic
964378279 3:156071079-156071101 CACAGTAGGAGGTGAGCAGAAGG + Intronic
965385237 3:168037960-168037982 CGCAGTGTGTGGGGCGCAGCAGG + Intronic
965470612 3:169085727-169085749 TCCAGTGTCTGCTGAGCAGAAGG + Intronic
967057909 3:185846159-185846181 AGCAGTGTGTGGTGGGGGGAGGG + Intergenic
968415339 4:427743-427765 CATAGTGTCTGGTGACCAGAAGG - Intronic
968771536 4:2510693-2510715 GGCAGGGTGAGGTGAGCAGTAGG + Intronic
969026549 4:4177757-4177779 AGGAGAGTGTGGTGGGCAGATGG - Intergenic
969202924 4:5620078-5620100 CTCAGAGTGTTGTCAGCAGAGGG - Intronic
969210907 4:5686508-5686530 GGCAGTGTGTGGAGATCAGCTGG - Intronic
969943921 4:10763301-10763323 GGCTGTGAGTAGTGAGCAGAAGG + Intergenic
970267436 4:14304341-14304363 CCCACTGTGTGCTGAGGAGAAGG - Intergenic
970384639 4:15543833-15543855 CCCAGTGAGTGGTGATGAGATGG - Intronic
972216898 4:36907467-36907489 CACTGTGTGTTGGGAGCAGAGGG - Intergenic
972782328 4:42296886-42296908 CTCAGTGCCTGGTGAGCAAATGG - Intergenic
975590516 4:75995158-75995180 GGGAGTGTGGGGTGAGCAGAGGG - Intergenic
975926487 4:79460901-79460923 CTAAATTTGTGGTGAGCAGAAGG + Intergenic
977883106 4:102228731-102228753 CTCTCTGTGTGGTGAGCAGCAGG - Intergenic
978886772 4:113774180-113774202 AGCAGTGTGAAGTGAGCAAATGG + Intergenic
980457148 4:133059246-133059268 CACATTGTTTGGGGAGCAGAAGG - Intergenic
982209865 4:153025539-153025561 CTCAGTGTCTCATGAGCAGAAGG + Intergenic
984593965 4:181646375-181646397 CACAGAGTGTGGTGATCTGAAGG + Intergenic
985844975 5:2337129-2337151 CGCAGTTTGAGATGAGGAGAGGG + Intergenic
986300327 5:6473473-6473495 GCCAGTGGGTGGTGAGCAGAAGG - Intronic
987072432 5:14351066-14351088 CACAGTGGGAGGTGAGCAGCAGG - Intronic
990447027 5:55903110-55903132 CCCAGGGCGTGCTGAGCAGAAGG - Intronic
990819061 5:59817047-59817069 CCCAGAGTGGGGAGAGCAGATGG - Intronic
991610409 5:68443755-68443777 TGCAGTGTGTGCAGAGCAGTGGG - Intergenic
992786811 5:80177796-80177818 CACAGTGTCTGGTGGGCAGATGG + Intronic
992871683 5:81012498-81012520 CGTAGCGTGTGGTCAGTAGACGG + Intronic
994236502 5:97369241-97369263 CGCAGTGGTTGATGGGCAGATGG + Intergenic
994843700 5:104957910-104957932 GCCAGTGTTTGGTGAGCAGTTGG - Intergenic
995004271 5:107171998-107172020 TGCAGTCTGTGGTGAGCAAGTGG - Intergenic
995433870 5:112113468-112113490 CTGAGTGTGTGGTGAGTAAATGG + Intergenic
997998724 5:138607156-138607178 CTCATTGTGGGGAGAGCAGAGGG - Intergenic
999304763 5:150512263-150512285 AGCAGTGTGTGGTCCACAGAGGG + Intronic
1001364336 5:171121894-171121916 AGCAGCGTGGGGTGAGTAGAGGG + Intronic
1002299200 5:178247943-178247965 GGCAGAGTCTGGTGAGCAGGTGG + Intronic
1002433801 5:179219510-179219532 CCCAGTGTGGGGCGAGGAGAAGG + Intronic
1002642725 5:180638106-180638128 AGCACTGTGTGTTGGGCAGAGGG - Intronic
1003557317 6:7151675-7151697 TGCAGTGTGTGCTCAGCAGTGGG - Intronic
1007168253 6:39843733-39843755 CTAAGTGTGTGGTGAGACGATGG + Intronic
1007274337 6:40662492-40662514 CGCCCTGTGTGTTCAGCAGAAGG - Intergenic
1007380796 6:41488867-41488889 AGCAGTGTGGGGTCAGCAGGTGG + Intergenic
1007408304 6:41647348-41647370 GGGAGTGTGTGGTGAGCTGAAGG - Intronic
1015314944 6:131807670-131807692 TGCAGCGTGTGGTCTGCAGAGGG - Intergenic
1016751794 6:147638325-147638347 TGAAGTCTTTGGTGAGCAGAAGG - Intronic
1016991124 6:149929262-149929284 GGCAGTGAATGGTGAGGAGAGGG - Intergenic
1018379526 6:163245673-163245695 CAGAGTGTGTGGTGGGGAGAGGG - Intronic
1018827667 6:167421778-167421800 CGCCGTGTGTGGGGAGCCGCAGG - Intergenic
1021596093 7:22318548-22318570 GGCAGACTGTGGTGAGCTGAGGG - Intronic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1024230463 7:47359871-47359893 GGCAGTGTGGACTGAGCAGAAGG + Intronic
1025850480 7:65239706-65239728 CGCGGTGTGTGGTGAGCAGCAGG - Intergenic
1025965058 7:66262122-66262144 TGCAGTCTGTGGTCAGCAAATGG + Intronic
1032155309 7:129463030-129463052 CGCAGTATATGGTAAGGAGATGG + Exonic
1033324359 7:140365128-140365150 CTCAGTGGGAGGAGAGCAGAAGG - Intronic
1035110172 7:156475333-156475355 CTCCGTGTGTGGTGAGCCGCAGG - Intergenic
1035740455 8:1924242-1924264 CTCAGTGAGGGGTGAGCAGAAGG - Intronic
1035950367 8:4013273-4013295 GGCAGTGTGGCCTGAGCAGATGG - Intronic
1037717357 8:21411677-21411699 GGCAGTTTCTGCTGAGCAGATGG - Intergenic
1037758209 8:21725011-21725033 TGCAGTGTGAGGTGAGTAGGAGG - Intronic
1037959538 8:23085503-23085525 TGCAGTCTCAGGTGAGCAGAGGG + Intronic
1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG + Intronic
1038816776 8:30912419-30912441 CGCAGTTTGTAGTCAGCAGAAGG - Intergenic
1039088821 8:33806409-33806431 GGCAGTGTGTGCTGGGGAGATGG + Intergenic
1039823508 8:41154373-41154395 CACAGCCTCTGGTGAGCAGATGG + Intergenic
1040287612 8:46108467-46108489 CGCATGGTGGAGTGAGCAGATGG - Intergenic
1040314495 8:46253834-46253856 CGCAGCGTGGCGTGGGCAGACGG + Intergenic
1040866864 8:52056307-52056329 TGCAGAGTGTGGTGAGCACCTGG + Intergenic
1042930043 8:74004200-74004222 CTCACTCTGTGCTGAGCAGAGGG + Intronic
1045343643 8:101275165-101275187 CAAAGGGTGTGGAGAGCAGATGG - Intergenic
1045552953 8:103188590-103188612 TGCAGGGTGTGTGGAGCAGAGGG + Intronic
1046940824 8:119929810-119929832 TTCAGTGTGTGATGAGCATAAGG + Exonic
1047162517 8:122396561-122396583 TGCAGAGTTTGGGGAGCAGAGGG - Intergenic
1048861408 8:138726931-138726953 TGCAGTCTGGGGTGACCAGAGGG + Intronic
1048981358 8:139704568-139704590 GGCAGAGAGTGGGGAGCAGAAGG + Intergenic
1049528464 8:143141720-143141742 CGCGCTGTGTGGGGACCAGAGGG - Intergenic
1050952852 9:11618806-11618828 AGCAGGGGGTGCTGAGCAGAAGG - Intergenic
1052691520 9:31821493-31821515 CCCACAGTGTGGTGAGCAGAGGG - Intergenic
1054841486 9:69745943-69745965 AGCAGTGACTGCTGAGCAGAGGG + Intronic
1056309046 9:85321288-85321310 GGCATTGTGTGGTGGGCAGCAGG - Intergenic
1056899378 9:90583922-90583944 GGCATTGTGTGGTGGGCAGCAGG - Intergenic
1057250254 9:93495100-93495122 GGCATTGTGTGGTGGGCAGCAGG + Intronic
1057906596 9:98988087-98988109 TGCAGTCAGAGGTGAGCAGAAGG + Intronic
1059179734 9:112200513-112200535 AGCAGTGTGGTGTGATCAGAAGG + Intergenic
1060423423 9:123485691-123485713 CGCAGTGTGGGGTCAGCTGCCGG + Intronic
1060954542 9:127629221-127629243 GGGAGTGTGTGGAGAGCAGTCGG + Intronic
1061754720 9:132804487-132804509 TGCAGTGAGGGGTGAGGAGAAGG + Intronic
1062129825 9:134886249-134886271 GGCAGGGTGTGCTGAGCAGCAGG - Intronic
1062396471 9:136354849-136354871 CACAGGGTGTGGTGGGCACAGGG + Intronic
1186227037 X:7410422-7410444 AGAAGTGAGTGCTGAGCAGAGGG - Intergenic
1189794149 X:44631524-44631546 CTCAGTGTGTGGTGATGTGATGG - Intergenic
1190471020 X:50779771-50779793 AGCAGTGTGTGTTTTGCAGATGG - Intronic
1192244668 X:69362539-69362561 GGCAGCATGTGGTGAGCAGCTGG - Intergenic
1192566256 X:72166197-72166219 GGAAGTGGGTGGTGAGCAAAAGG - Intergenic
1192596593 X:72414743-72414765 TGCAGTGGCTGGAGAGCAGAAGG + Intronic
1193911015 X:87306568-87306590 CACAGTGGGAGGTGAGCAGTGGG + Intergenic
1193980105 X:88171959-88171981 TGAAGTGTGTGGTTAGCTGATGG + Intergenic
1195761249 X:108248770-108248792 CACAGTGAGAGGTGAGCAGAGGG + Intronic
1197708413 X:129649976-129649998 GGCAGTGTGTGGAGATGAGATGG + Intronic
1199372562 X:147068483-147068505 TGCAGTGTGTGGAGATCACATGG + Intergenic