ID: 1178942419

View in Genome Browser
Species Human (GRCh38)
Location 21:36917163-36917185
Sequence CAGATCATGTAGGAGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178942419_1178942422 5 Left 1178942419 21:36917163-36917185 CCTGCCAGCTCCTACATGATCTG 0: 1
1: 0
2: 0
3: 27
4: 217
Right 1178942422 21:36917191-36917213 TTTTGTTCTGCTGTTAATCGTGG 0: 1
1: 0
2: 0
3: 11
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178942419 Original CRISPR CAGATCATGTAGGAGCTGGC AGG (reversed) Intronic
904113502 1:28145015-28145037 CAGAACATCTTGGAGCTGGGAGG - Intergenic
904373251 1:30064120-30064142 CATGGAATGTAGGAGCTGGCAGG - Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
906824068 1:48959864-48959886 CAGATCATGTAGGGCCTTGTAGG + Intronic
907875481 1:58482856-58482878 CAGATTATGTAGGACCTCACAGG + Intronic
907935867 1:59041863-59041885 CAGAGCATGTTTGAGCTCGCTGG - Intergenic
910322641 1:85965902-85965924 CAGGTCATGTAGGGCCTTGCAGG + Intronic
910624059 1:89287537-89287559 CAGATCGTGTAGAATCTTGCAGG - Intergenic
910902319 1:92134354-92134376 CAGATCATGGAGGGTCTTGCAGG - Intronic
911061015 1:93747907-93747929 CAGGTAATGTTGGAGCAGGCAGG - Intronic
911380366 1:97106594-97106616 CAGATGGTGGAGGAGATGGCTGG - Intronic
916184650 1:162119027-162119049 CAAATCATGTGAGAGCTGGATGG + Intronic
917015684 1:170528980-170529002 GAGATCATGTAGGAACATGCAGG + Intergenic
917944547 1:179955145-179955167 GAGCTCCTGTAGGACCTGGCTGG + Intronic
918148656 1:181780034-181780056 CAGACCATCCAGGAGCTGGGAGG - Intronic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
923403237 1:233636139-233636161 CAGATCATGTAGGACCTTATGGG + Intronic
923719578 1:236455428-236455450 CAGATCTTGTTGGAGCTTGAAGG - Intronic
923765473 1:236889098-236889120 CAGAGCAGTGAGGAGCTGGCAGG + Intronic
1064729970 10:18320115-18320137 CAGTTTATGGAGGAGCTGACAGG - Intronic
1065412207 10:25442016-25442038 CAGACCATGAAGGAGCTAGAAGG + Intronic
1070085430 10:73232433-73232455 CTGAGCAAGTTGGAGCTGGCAGG - Intronic
1071335993 10:84601001-84601023 CAGAATTTGGAGGAGCTGGCAGG - Intergenic
1073002073 10:100293321-100293343 GAGGTCAAGGAGGAGCTGGCTGG - Exonic
1073449808 10:103602675-103602697 CATGTCATGTACGAGGTGGCTGG + Exonic
1075904105 10:126065704-126065726 CAGATCTTCTAGAAGTTGGCAGG - Intronic
1077906991 11:6542272-6542294 GAGATCAAGTAGGAGCAGACTGG - Intronic
1079386845 11:19988024-19988046 CAGTGCATGTAGGAACTGGCAGG - Intronic
1082773124 11:57224242-57224264 CAGGTCATGTAGGACCTTGAAGG - Intergenic
1083446994 11:62714827-62714849 CACAGCAGGTAGGAGCAGGCAGG - Exonic
1084164349 11:67368068-67368090 CAGCACATGTCAGAGCTGGCAGG + Intronic
1085645687 11:78220976-78220998 CAGATCTTGGAGGAGCTAGGCGG - Intronic
1089730548 11:120516288-120516310 CAGACCTGGCAGGAGCTGGCAGG + Intronic
1089950780 11:122524190-122524212 CAGAGCATGTAGGAGTTGGGGGG - Intergenic
1093917171 12:24817368-24817390 CACATTATGTTGTAGCTGGCTGG - Intronic
1094055506 12:26265432-26265454 TAGATCATGAAGGACCTTGCAGG + Intronic
1095700504 12:45186220-45186242 CAGATCATGTAGGGCCTTACAGG + Intergenic
1095909270 12:47409372-47409394 CAGATCATGGAGGGCCTGGAAGG - Intergenic
1096256781 12:50067141-50067163 GAGATACTATAGGAGCTGGCAGG - Intronic
1096558942 12:52422365-52422387 CAGCTCATGATGGACCTGGCTGG - Intergenic
1098252521 12:68584961-68584983 CAGGTAATGCAGGAACTGGCAGG + Intergenic
1099318679 12:81117621-81117643 CAGATCATATAGAACCTTGCAGG + Intronic
1099496889 12:83359310-83359332 CAGATCATGTAGGATGTTGTAGG + Intergenic
1101050673 12:100860441-100860463 CAGATAAAATAGGAGCTGGCAGG - Intronic
1103418781 12:120763160-120763182 CAGAACAGGGAGGAGATGGCTGG + Exonic
1107111219 13:36700104-36700126 CAGACTATGTAGGAACTGGTAGG + Intergenic
1107175219 13:37391953-37391975 CAGATCATGTAGGGCTTTGCAGG + Intergenic
1110064765 13:71089386-71089408 CAGATCATGTAGAACCTGGTGGG + Intergenic
1110639217 13:77802530-77802552 AAGATCATGTAGGAGCTTGTAGG + Intergenic
1111908956 13:94288493-94288515 CAGATAATGCAAGAGCTTGCAGG - Intronic
1113231599 13:108218433-108218455 CAGGTTATGTGGGAGCCGGCGGG + Exonic
1114636701 14:24191218-24191240 CAGATTATGTAGTAGCTACCTGG - Intronic
1116942984 14:50809336-50809358 CAGATCCTGGAGGAGAAGGCAGG - Intronic
1117828730 14:59729288-59729310 CAGATCATGTAGGATCTCATGGG + Intronic
1119778845 14:77265117-77265139 CAGAGCATGGAGGAGCATGCAGG + Intergenic
1119947437 14:78709648-78709670 CAGATCAGGTAGGAAGAGGCAGG + Exonic
1120721688 14:87895999-87896021 CAGGTCATGTGTGAGCTGTCGGG - Intronic
1120810881 14:88802422-88802444 CAGAGCAGGGAGGAACTGGCTGG - Intergenic
1122043830 14:99009363-99009385 GAGATCAGGTGGGAGGTGGCTGG + Intergenic
1125900629 15:43343337-43343359 CAGATCATGTGGGACCTTGTAGG - Intronic
1126289668 15:47059285-47059307 CAGTTCAACTAGGAGCTAGCTGG + Intergenic
1128251676 15:66168116-66168138 TCCATCAGGTAGGAGCTGGCGGG - Intronic
1129196401 15:73969786-73969808 CAGCTCATGTAGGGCCTGGTAGG - Intergenic
1133198808 16:4189878-4189900 CACAGCATGGAGGAGCAGGCAGG + Exonic
1133277419 16:4647197-4647219 CACATCTTGGAGGAGCAGGCAGG + Intronic
1133722334 16:8506716-8506738 CAGATGATGAAGGGCCTGGCAGG + Intergenic
1133822913 16:9252737-9252759 AAGATGATGTATGAGCTGTCAGG + Intergenic
1137358118 16:47786427-47786449 CAGATCATGTGGGGCCTTGCAGG - Intergenic
1138044357 16:53705312-53705334 CAGATCATGCAGGATCTTGTAGG - Intronic
1138369742 16:56517290-56517312 CAGATCATATAGGAACTTGTAGG - Intronic
1138382110 16:56609676-56609698 CAGATCATATGGGAGCAGGAGGG + Intergenic
1138586965 16:57976752-57976774 TAGATCATGGAGGAGCAGGGAGG - Intronic
1140111987 16:72012480-72012502 CAGCTCATGGAGCAGCTGGGAGG - Intronic
1142310816 16:89312464-89312486 CAGAAATGGTAGGAGCTGGCGGG + Intronic
1143092964 17:4460201-4460223 CAGATCATGTAGGATGTTGTGGG + Intronic
1143266230 17:5640024-5640046 CAGGTCATGAAGCAGGTGGCAGG - Intergenic
1143474051 17:7192930-7192952 CAGAGCAGGTAGGACCTGGCGGG - Exonic
1145196195 17:20896583-20896605 CAGGCCAAGTAGGAGCTGGGCGG - Intergenic
1145834129 17:27940919-27940941 CAGATCCCGTTGGAACTGGCTGG - Intergenic
1147235782 17:39056514-39056536 CAGATGATGTGGGAGATGGGAGG - Intergenic
1149451861 17:56755934-56755956 CAAATCATGCAGGAGCTTGGGGG - Intergenic
1149578698 17:57732243-57732265 CAGATCAGCTGGGGGCTGGCTGG + Intergenic
1149895262 17:60424088-60424110 CAGTTCATGTGAGAGCTGGTTGG - Intronic
1151621308 17:75246712-75246734 CAGATCAACAAGGAGCTGGAAGG - Exonic
1152380808 17:79941507-79941529 CAGATCCTGCAGGAGCTGAGAGG - Intronic
1155442937 18:25880976-25880998 CAGATCATGTAGGGTCTAGAGGG + Intergenic
1157195878 18:45619787-45619809 CAGATGAAGTACAAGCTGGCTGG - Intronic
1157545430 18:48543181-48543203 CAGGTCATGAAGGAGGAGGCAGG + Intronic
1159076133 18:63683987-63684009 CGGATCATGTAGGAAGTGGTGGG - Intronic
1160680565 19:410097-410119 CAGATCACGAAGCAGCTGGCAGG - Intergenic
1160859587 19:1232048-1232070 CAGACCAGGGTGGAGCTGGCAGG - Intronic
1162028715 19:7908351-7908373 CAGCTCCTGCAGGGGCTGGCAGG + Intronic
1162028891 19:7909050-7909072 CAGCTCCTGCAGGGGCTGGCGGG - Intronic
1162828761 19:13270910-13270932 TAGATCATGCAGGAACTGGGAGG - Intronic
1163816888 19:19471860-19471882 CAGATGAGGCTGGAGCTGGCAGG + Intronic
1165661326 19:37582989-37583011 CAAATCATGTAGGACCTTGTTGG - Intronic
1166563672 19:43750164-43750186 CAAATCATGTAGGACCTGGTAGG - Intronic
925243599 2:2358370-2358392 CTGACCTTGTAGGAGCTTGCAGG + Intergenic
928624082 2:33121631-33121653 CATTCCATGGAGGAGCTGGCTGG + Intronic
932366240 2:71155241-71155263 CAGTTCATGAAGGTGCTGGCAGG + Intergenic
936327980 2:111522087-111522109 CAGAGCAGGGAGGAGCAGGCTGG + Intergenic
938757949 2:134397786-134397808 CAGTTCATGCAGGAGGGGGCTGG + Intronic
939357961 2:141128419-141128441 CAGATTATGTAGGACCTGACTGG - Intronic
939420842 2:141966500-141966522 TAGATGCTGCAGGAGCTGGCTGG - Intronic
939629554 2:144516539-144516561 CAGACCATGTAGAAACTGCCGGG + Intronic
940415683 2:153417298-153417320 CAGATGATGTAGGGCCTTGCAGG + Intergenic
942797233 2:179835756-179835778 CATATCATGTGGGTCCTGGCTGG + Intronic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
944395529 2:199262213-199262235 CAGATCATGTAGGGCCTTGCAGG + Intergenic
945326734 2:208491089-208491111 TAGTTCATTTAGGAGTTGGCTGG + Intronic
945498861 2:210543324-210543346 CAGACCCTGTAGGTGTTGGCAGG - Intronic
946894617 2:224310643-224310665 CAGAGCATGAAGGTCCTGGCAGG - Intergenic
947634259 2:231672263-231672285 CAGACCTTTGAGGAGCTGGCTGG + Intergenic
948035101 2:234852162-234852184 CACAGCATGAGGGAGCTGGCAGG - Intergenic
948202820 2:236142203-236142225 CAGATCACGTAGGACCTTGCAGG - Intergenic
948320636 2:237065972-237065994 AAGATCATGTAAGTCCTGGCAGG - Intergenic
1169477469 20:5945229-5945251 CAGATCATTTATGACCTTGCAGG - Intronic
1170206156 20:13800822-13800844 CAGATCGTCTGGGAGCTAGCTGG + Intronic
1172447415 20:35000477-35000499 CAGCTCAAGGAGGAGCAGGCAGG + Exonic
1173029075 20:39337940-39337962 CAGATCATGGAGGACCTTCCAGG - Intergenic
1173587446 20:44193615-44193637 CAGATCATGGAGGGCCTGGTAGG - Intergenic
1175112252 20:56656896-56656918 CAGAGCATGCAGCATCTGGCCGG + Intergenic
1175629729 20:60525402-60525424 GAGATCAAGTAAGAGCTGGAGGG - Intergenic
1176032817 20:63021880-63021902 CAGATGATGTGGGCGCAGGCGGG + Intergenic
1176167066 20:63679922-63679944 CAGATCATCCAGCACCTGGCAGG + Exonic
1178942419 21:36917163-36917185 CAGATCATGTAGGAGCTGGCAGG - Intronic
1179592209 21:42416289-42416311 CACATCATAAAGGAGATGGCTGG - Intronic
1180044796 21:45300298-45300320 CAGAGCTTGCTGGAGCTGGCTGG + Intergenic
1180079689 21:45480977-45480999 CATCTCCTCTAGGAGCTGGCGGG + Intronic
1180618619 22:17145262-17145284 CAAATCCTGCAGGTGCTGGCAGG + Intronic
1183330714 22:37219529-37219551 CATATCATGTGAGAGCTGGATGG + Intergenic
1183992335 22:41606054-41606076 CAGATCAGGTAGGTCCTGGGAGG + Intronic
1184302928 22:43573121-43573143 CTGATCATTTAGGAAATGGCAGG + Intronic
1185412844 22:50695041-50695063 AAGATCAGGTAGGAGGGGGCTGG + Intergenic
949875279 3:8622645-8622667 CGGATCATCTTGGAGCTGGAAGG - Intronic
951097444 3:18648548-18648570 CAGACCATGTTGAAGCTGGAAGG + Intergenic
952166838 3:30759087-30759109 CAGATCACGATGGAGCTGGTTGG + Intronic
953265122 3:41379637-41379659 TAGAACATTTAGGAGATGGCTGG - Intronic
954111098 3:48433631-48433653 CAGATCATGGAGGGGCCGGGTGG - Intronic
955359821 3:58263720-58263742 GAGATCATGGAAGAGCTGGAAGG - Intronic
956499292 3:69864695-69864717 CAGACCATGAAGGATCTGGTAGG - Intronic
957413617 3:79872654-79872676 AAGTTCATGTAAGTGCTGGCTGG + Intergenic
959208945 3:103351063-103351085 CAGATCATGTAGGATCTTTTAGG + Intergenic
960486954 3:118264949-118264971 CAGATCATGTAGGGCCTTTCAGG + Intergenic
961751940 3:129101745-129101767 CAGAGCATATAGGATCTTGCAGG + Intronic
964931140 3:162024898-162024920 CAGGTCATGGAGGGGCTTGCTGG - Intergenic
966160495 3:176962491-176962513 CAGGTCATGCAGGACCTTGCAGG + Intergenic
967811385 3:193763999-193764021 CAAGTCATGTAGGACCTGGTGGG - Intergenic
969641982 4:8404315-8404337 TAGTTAATGTTGGAGCTGGCAGG - Intronic
971214910 4:24653759-24653781 CCAATCAAGTAGGAGCTTGCTGG + Intergenic
972293482 4:37714256-37714278 CAGTTCAGGTATTAGCTGGCAGG + Intergenic
974010092 4:56598733-56598755 CAGATCATGTAGGGCCTTGTAGG + Intronic
975791222 4:77953971-77953993 CAGAAGATATAGGAGATGGCGGG + Intergenic
978112208 4:104976891-104976913 CAGATGATGCAGGAGTTGCCAGG - Intergenic
978761120 4:112357239-112357261 CAGATCATCCAGCATCTGGCAGG + Intronic
979612105 4:122700302-122700324 GAGATAAGGGAGGAGCTGGCCGG + Intergenic
981702296 4:147619934-147619956 CAGATCATGTTGGACCTTGATGG - Intronic
984677536 4:182567494-182567516 CAGGTCATGTAGAATCTGGAAGG - Intronic
984823268 4:183903187-183903209 CAGATCATGCCGGAACTTGCAGG - Intronic
985493445 5:192131-192153 CAGCACGTGCAGGAGCTGGCTGG - Exonic
985756983 5:1725092-1725114 CAGATCAGGGAGGAGCTGCCGGG - Intergenic
985877684 5:2612804-2612826 CAGAACACAGAGGAGCTGGCTGG + Intergenic
991933601 5:71780820-71780842 CAGAGCATGGAGGGCCTGGCAGG - Intergenic
992001233 5:72438413-72438435 CAGACCCCGAAGGAGCTGGCAGG - Intergenic
992763148 5:79969652-79969674 CAGACCAGGTAGGAGCTTGAAGG - Intergenic
993196766 5:84758413-84758435 CAGATCTTGTGGGAGCTCACTGG - Intergenic
997448797 5:133965038-133965060 CAGATCATGTAGGATCTTGAAGG - Intronic
998183357 5:139960928-139960950 GAGTTCATGGAGGAGCTGGCAGG - Intronic
998692627 5:144604021-144604043 CAGATCAAGTAGGACCTTGCAGG + Intergenic
998895334 5:146792839-146792861 CAGATGATGTAGGGTCTTGCAGG + Intronic
999559162 5:152781166-152781188 CAGATCATGTAGGGCCTTGCAGG - Intergenic
999861393 5:155650687-155650709 CAGATCATGTAAGAACTTGTGGG + Intergenic
1001300769 5:170532034-170532056 GAGGTCATGGAGGAGTTGGCCGG - Intronic
1002506324 5:179681641-179681663 TAGGTGCTGTAGGAGCTGGCTGG - Intronic
1005083684 6:21981850-21981872 CAGATCAGGAAGGAGGAGGCAGG - Intergenic
1006453030 6:34116048-34116070 CAGATCCTTCAGGAGTTGGCTGG + Intronic
1006798382 6:36744793-36744815 CAGATCATGAGAGATCTGGCTGG - Intronic
1007374666 6:41448314-41448336 CAGAGCATGTAAGACCTGGCAGG - Intergenic
1007528078 6:42514341-42514363 CAAATCATGCAGGGGCTTGCAGG + Intergenic
1007829949 6:44630364-44630386 CATAGCATGTAAGAGCTGGAAGG + Intergenic
1008775764 6:55035719-55035741 CAGATCATGTAGGACCCCGTAGG - Intergenic
1010611348 6:77957516-77957538 CAAATCATGTAGGATTTGGCAGG + Intergenic
1012188126 6:96247298-96247320 CAGATCATGTAGGACTTTGTAGG + Intergenic
1012969422 6:105711714-105711736 CAGAGCATGTAAGACCTTGCAGG - Intergenic
1013037543 6:106401053-106401075 TGGATGATGTAGGAGCTTGCAGG - Intergenic
1014198848 6:118587043-118587065 CAGATATTGTAGGAGCTAGATGG - Intronic
1015009710 6:128330743-128330765 CAGATCATGTTGAAGCTGAGGGG - Intronic
1016492007 6:144615898-144615920 CTGATCATGTAGGACCTGGTAGG - Intronic
1019257072 7:59329-59351 GAGCCCATGTAGGAGGTGGCTGG + Intergenic
1019936431 7:4261272-4261294 CAGATGAGGGAGCAGCTGGCAGG + Intronic
1023868325 7:44249426-44249448 CAGTGCATGAAGGAGCTGGCTGG - Intronic
1024417240 7:49120960-49120982 AACAACATGCAGGAGCTGGCAGG + Intergenic
1026241768 7:68581716-68581738 CAGATCATGTAGGGTCTTGTAGG - Intergenic
1026798695 7:73383227-73383249 CAGGTCAGCTGGGAGCTGGCTGG - Intergenic
1030740258 7:113101092-113101114 CAGATCATGTAGGTCATGGCAGG - Intergenic
1031417965 7:121516084-121516106 CAGATCTTGTAGGATCTTGAAGG - Intergenic
1033036194 7:137878485-137878507 CAGATCCTGTTGGGCCTGGCTGG - Exonic
1033127813 7:138720382-138720404 CTGCTCATGTTGGAGGTGGCAGG + Intronic
1033684519 7:143626063-143626085 CAGGTCATGTAAGAACTGACAGG + Intronic
1033687695 7:143705282-143705304 CAGGTCATGTAAGAACTGACAGG + Intronic
1033700092 7:143831560-143831582 CAGGTCATGTAAGAACTGACAGG - Intergenic
1034440576 7:151083635-151083657 CAGATCGCGAAGGGGCTGGCGGG + Intergenic
1035294773 7:157860844-157860866 CAGCTCAGGCAGCAGCTGGCCGG + Intronic
1035717486 8:1764615-1764637 CAGAACCTGTAGGAGCGGGGAGG + Intronic
1037638210 8:20719548-20719570 CAGAGCCTGCAGGAGCTAGCTGG + Intergenic
1043151072 8:76716665-76716687 CAGATGTAGTAAGAGCTGGCTGG + Intronic
1046814417 8:118568383-118568405 CAGATCATGCAGGATCTGGTAGG + Intronic
1047410295 8:124619192-124619214 CAGAGCATTTGGGAGCTGCCGGG - Intronic
1048334815 8:133494639-133494661 CAGTTCATGTAGGATCTTGCAGG - Intronic
1049120781 8:140735236-140735258 CAGCTCAGGTAGGAGTTGGCGGG - Exonic
1050412931 9:5385061-5385083 CAGATCATGTGGGACCTTCCAGG + Intronic
1050792887 9:9495991-9496013 CAGCTCCCGTAGCAGCTGGCTGG + Intronic
1052395303 9:27931147-27931169 CAAATCAAGTAGGGTCTGGCAGG - Intergenic
1052994264 9:34541834-34541856 TTGAACATGTAGGAGTTGGCTGG + Intergenic
1054861835 9:69961793-69961815 CAGATCATGATGGATCTTGCAGG + Intergenic
1055392530 9:75838390-75838412 CAGATCATGGAGAACCTGGTGGG - Intergenic
1057030270 9:91769763-91769785 CAGATCATGAAGGTACTGGAGGG - Intronic
1057040301 9:91843119-91843141 AAGAGCATGTTGGAGCTGGAGGG + Intronic
1059866794 9:118523285-118523307 CAGGTCAAGTAGGACCTGGTAGG - Intergenic
1059969023 9:119645388-119645410 CAGGTCAGCTAGGAACTGGCTGG - Intergenic
1060463655 9:123882931-123882953 CAGATCATGTAGGACTTTGTAGG - Intronic
1060816805 9:126639333-126639355 CAGATGATGGAGGGGCAGGCTGG - Intronic
1060841235 9:126794602-126794624 CAGATCAGTTAAGGGCTGGCTGG - Intergenic
1061427892 9:130512126-130512148 CAGATCATGAAAGTGCTGGTAGG - Intergenic
1062610573 9:137371632-137371654 CTGATCATGTATGAGGAGGCCGG - Intronic
1186368819 X:8925808-8925830 GAGATTACGTAGGAGCTGGAAGG + Intergenic
1187927560 X:24263896-24263918 CAGAGCATGTGGGACCTTGCAGG - Intergenic
1188232150 X:27677663-27677685 CAGGTCATGCAGGACCTTGCAGG + Intronic
1189145963 X:38655055-38655077 CAGGTCAAGTAGGACCTTGCAGG + Intronic
1189537986 X:41956206-41956228 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1190489342 X:50965394-50965416 CAGATCATGTAGGATTTTGTAGG - Intergenic
1190853077 X:54265553-54265575 CAGATCCTGTAGGACTTTGCAGG + Intronic
1191603910 X:63041289-63041311 CAGATTATGTGGCAGCTGGCTGG - Intergenic
1192273832 X:69610180-69610202 CAGATCATGTAGGGCCTTGTAGG + Intergenic
1192305758 X:69957809-69957831 CACATCATGTAAGTGCTAGCAGG - Intronic
1192481136 X:71487171-71487193 CAGATCATCAATGAGCTGGGGGG - Intronic
1194537090 X:95119072-95119094 AAGCACATGTAGGAGATGGCTGG + Intergenic
1197741707 X:129900057-129900079 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1198778558 X:140208263-140208285 CAGATCAGGTAGGGGCTTGTGGG + Intergenic
1199988497 X:152969846-152969868 TAGATCATGTAGGCCTTGGCGGG + Intronic
1200303029 X:154997727-154997749 CATAACATGTAGGACCTTGCAGG + Intronic
1202361636 Y:24116898-24116920 CAAATCATGTAGCAACTTGCTGG - Intergenic
1202363437 Y:24136198-24136220 CAAATCATGTAGCAACTTGCTGG + Intergenic
1202507343 Y:25533919-25533941 CAAATCATGTAGCAACTTGCTGG - Intergenic
1202509142 Y:25553215-25553237 CAAATCATGTAGCAACTTGCTGG + Intergenic