ID: 1178942591

View in Genome Browser
Species Human (GRCh38)
Location 21:36918943-36918965
Sequence ATGTCTAATTGGAAACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178942591 Original CRISPR ATGTCTAATTGGAAACTGGA AGG Intronic
903223673 1:21883061-21883083 CTGTCTGATTGGAATCTGGGTGG - Intronic
904131361 1:28277976-28277998 ATGACTGGCTGGAAACTGGAGGG - Intronic
904152118 1:28450408-28450430 CTGTCAAATTGGAAATTAGAGGG + Intronic
904532869 1:31180820-31180842 TTCTCTTATTGGGAACTGGATGG - Exonic
906751158 1:48262427-48262449 ATGTGCAAGTGGAAAATGGATGG - Intergenic
907157428 1:52347318-52347340 ATGTCTGATTCTATACTGGAAGG - Intronic
907771075 1:57464368-57464390 ATTTTTAAATGGAAACTGGATGG - Intronic
908077500 1:60536492-60536514 ACATGTTATTGGAAACTGGAAGG - Intergenic
908464041 1:64374175-64374197 AAGTTAAATTGAAAACTGGAGGG - Intergenic
908906003 1:69010326-69010348 AAGTCTAATTGGAAATTCAAAGG - Intergenic
909113646 1:71508476-71508498 AAGTCAAAATGGAAACTGGCAGG + Intronic
911230980 1:95361459-95361481 ATTTCTTATTGTCAACTGGAAGG - Intergenic
911445589 1:97987762-97987784 ATATGTTATTGGAAACTGGAAGG - Intergenic
914229859 1:145755799-145755821 AAATCTGATTAGAAACTGGAGGG + Intronic
915439044 1:155932962-155932984 ATCTCTAATTAGAACCTGTAGGG - Intronic
915741376 1:158121134-158121156 AATTCTAATTAGATACTGGAAGG - Intergenic
916072461 1:161178338-161178360 ATGGCTAATGGGAAACCTGAAGG + Intergenic
916309407 1:163378476-163378498 ATATCTCCTTGGAAACAGGAAGG + Intergenic
916515233 1:165510460-165510482 ATGCCTAATTGGAATGTGCAAGG - Intergenic
917627771 1:176863318-176863340 ATGTCTGATTGGGACCAGGAGGG - Exonic
918925518 1:190780865-190780887 AGGTCTAATTAAACACTGGAAGG - Intergenic
919117861 1:193303604-193303626 ATGTCCAATTGTCACCTGGAGGG + Intergenic
919372326 1:196743588-196743610 GTGTTTAAATGGAAACTGGACGG + Exonic
921232011 1:213082522-213082544 AAGTGTTACTGGAAACTGGAGGG + Intronic
921249490 1:213282998-213283020 ATCTGTGATTGGAAACTAGATGG + Intergenic
922689568 1:227677552-227677574 AGGTCAAAATGGAAACTGGCAGG + Intergenic
924405400 1:243739860-243739882 ATTTCTAATTTGAAACCTGAGGG - Intronic
924805467 1:247358142-247358164 AGGTCAAAATGGAAACTGGCAGG + Intergenic
1062949111 10:1483850-1483872 GTGTCATATTTGAAACTGGAGGG - Intronic
1063902298 10:10746963-10746985 ATTTCTAACTGAGAACTGGATGG + Intergenic
1064917894 10:20482253-20482275 ATGTCTAAATGGGGACTGGATGG - Intergenic
1067671879 10:48331337-48331359 AGGTCAAAATGGAAACTGGCAGG - Intronic
1069094304 10:64239789-64239811 ATGGCTAATAGGAAACTAAAAGG - Intergenic
1070204121 10:74238948-74238970 AAGTATCATTTGAAACTGGAAGG - Intronic
1070490673 10:76973282-76973304 ATGAGTACTTGGAGACTGGATGG - Intronic
1073626549 10:105103471-105103493 ATGATGAATTGGAAACTGGATGG - Intronic
1074710418 10:116172685-116172707 ATGTGTAAGTGGAAAGTGGAGGG + Intronic
1076459001 10:130625713-130625735 ACGTGAAAATGGAAACTGGATGG + Intergenic
1077901349 11:6491785-6491807 ATCTCTAATTGGTAACAGTAAGG + Intronic
1078410144 11:11107977-11107999 ATGTCTAAATGGATAGTGAAAGG + Intergenic
1079658648 11:23014024-23014046 ATGTCAAAGTGAAAACTGCATGG - Intergenic
1080452950 11:32393744-32393766 ATGCCTGCTTGGAAACTGCATGG + Intronic
1080698462 11:34623628-34623650 TTAGCGAATTGGAAACTGGAAGG + Intronic
1081141981 11:39512805-39512827 ACATATTATTGGAAACTGGAAGG - Intergenic
1084079387 11:66810891-66810913 ATGTGTAATTGGAGCCTGAAGGG - Intronic
1087834524 11:102859315-102859337 ATGTCTAGTAGGTAACGGGATGG - Intergenic
1088679685 11:112228290-112228312 ATGTTGAATTGAAAAGTGGAAGG + Intronic
1089690026 11:120181415-120181437 ATGTCTTATTAGTACCTGGAAGG + Intronic
1091310204 11:134568578-134568600 ATGTATAATTGGAACCTATAAGG - Intergenic
1091481000 12:830682-830704 CTGTCTAATTGAAACCTGAAAGG + Intronic
1093001109 12:13997119-13997141 ATGGCTAAGTGGAAATAGGAAGG + Intergenic
1097241680 12:57580092-57580114 TTGTCCAAATGGAAACTGCATGG + Intronic
1097345008 12:58481482-58481504 ATGTGGAATTTGAAACTGAATGG - Intergenic
1097788066 12:63783108-63783130 ATGTGTTATTAGAAACTGGAAGG - Intronic
1099047370 12:77738133-77738155 GGGTCTAATTGGATTCTGGATGG + Intergenic
1099146886 12:79057790-79057812 GTGTCTAATTGTAAGCAGGAAGG - Intronic
1099844556 12:88013184-88013206 ATGCTTAATTGTAAATTGGATGG + Intronic
1104152758 12:126100263-126100285 AGGACTCATTGGAAACTGGCTGG - Intergenic
1106527808 13:30558646-30558668 ATGTCTTTTTGGAAAAAGGAAGG - Intronic
1107076544 13:36327129-36327151 ATGTCTAATTTGAAACAAGAAGG + Intronic
1108743484 13:53363935-53363957 ATATCTAATTGAAAACTAAATGG + Intergenic
1108935158 13:55873565-55873587 AGGTCAAAATGGAAACTGGCAGG - Intergenic
1109171291 13:59100104-59100126 ACATCTCATTGGAAAGTGGAGGG - Intergenic
1112029801 13:95446891-95446913 ATCTCTAATTGATATCTGGAAGG + Intronic
1112675211 13:101693501-101693523 ATGTCTTATTGGAGGGTGGAGGG + Intronic
1114716825 14:24835147-24835169 GTGTTTAATTTGAATCTGGAAGG + Intronic
1114851015 14:26382497-26382519 ATGTGTTATTGCAAAATGGATGG + Intergenic
1116090704 14:40301474-40301496 ATCTTTAATTGGAAATTTGAAGG + Intergenic
1116188008 14:41623680-41623702 AGTTTTAATTGGAAACTGTAGGG + Intronic
1116968064 14:51035329-51035351 AGATCTAAGTGGAAACTTGAGGG + Intronic
1119982083 14:79093245-79093267 ACATCTAATTGGAATATGGAAGG + Intronic
1126340390 15:47634897-47634919 ATGTCTGACTGGAATGTGGAAGG + Intronic
1127026013 15:54807552-54807574 ATTTCTAAGAGGTAACTGGATGG + Intergenic
1129324293 15:74791933-74791955 CAGGCTAATTGGAAACAGGAAGG - Intronic
1131598605 15:93824705-93824727 AGGGCTAATTGGACCCTGGAAGG + Intergenic
1132163261 15:99563004-99563026 ATGCCTAAGTGGAGACTTGATGG + Intergenic
1134299972 16:12982031-12982053 AAGTCTAATTTGAAAGTTGATGG - Intronic
1140588043 16:76317923-76317945 CTGTCAAATGGGAAACTGGGGGG + Intronic
1142057728 16:88009998-88010020 ATGTCTCATTGGAATAAGGACGG + Intronic
1143952924 17:10647845-10647867 ATATCTAATTTCAAACTGTAGGG - Intronic
1145880543 17:28349658-28349680 ATGTGTGAATGGACACTGGAGGG - Intronic
1146450678 17:32971648-32971670 AGGTCAAAATGGAAACTGGCAGG + Intronic
1146978754 17:37139917-37139939 ATGACCAATTGGAAATTGAATGG - Intronic
1150644042 17:66967063-66967085 ATTTCCACTGGGAAACTGGAAGG - Intronic
1150781245 17:68124232-68124254 ATAACTAATTAGAAAATGGAAGG + Intergenic
1152232623 17:79121924-79121946 ATGTCCAAGTGGAGACTGCAAGG - Intronic
1154056465 18:11017188-11017210 ATGTCTAATTGTCAAATGGATGG + Intronic
1156185710 18:34660764-34660786 ATTTCTAATTGGCAATTGGTTGG - Intronic
1159394738 18:67841496-67841518 AGGTGAAATTGGAAGCTGGAAGG - Intergenic
1159713772 18:71796500-71796522 ATATCATATTGGAAACTAGAGGG + Intergenic
1162285942 19:9738889-9738911 ATGTCTATTTGGAACCTGTTAGG + Intergenic
1162891919 19:13739694-13739716 AGCTCTAATTGGTGACTGGAAGG - Intronic
1166660159 19:44641817-44641839 ATTTCTAAATGGAAACAGGGAGG - Intergenic
1168419429 19:56191533-56191555 ATGTCTTTGCGGAAACTGGATGG + Intronic
1168421571 19:56207552-56207574 ATGTCTTTGAGGAAACTGGATGG - Intronic
926350907 2:11993579-11993601 ATATATGATTGGAAACTGGAGGG + Intergenic
927377536 2:22435610-22435632 CTCCCTAATTGGAAAATGGATGG - Intergenic
927620183 2:24647777-24647799 ATGTGAAAGTGGCAACTGGAAGG + Intronic
933328957 2:80873037-80873059 AGGTCTAATCTGGAACTGGAAGG - Intergenic
937094266 2:119225272-119225294 ATGTCTAATGGGTAAGTGGGCGG + Intronic
938669431 2:133572927-133572949 ATGTCTGATTGTAGACTAGAAGG - Intergenic
939859969 2:147407614-147407636 ATGCCTATTTGGAAACTGCTGGG - Intergenic
940246498 2:151623746-151623768 ATGTTTCTTTTGAAACTGGAAGG + Intronic
941138814 2:161751079-161751101 ATGTATAAGTGGAAATTGAAAGG - Intronic
941744297 2:169070035-169070057 ATGATTAATTGGAAACTGGAGGG + Intronic
943256862 2:185605196-185605218 ATGTGTTATCGGAAACTTGAAGG + Intergenic
943953279 2:194157158-194157180 AGGTCAAAATGGAAACTGGTGGG - Intergenic
944549452 2:200831962-200831984 AAGTCTAATTGGGAACCAGATGG - Intergenic
945626303 2:212211251-212211273 GTGTTTAAATGGAAACTGGAGGG - Intronic
946006832 2:216532436-216532458 ATGTCAAAAAGGAAACTGGGTGG - Intronic
948062889 2:235054599-235054621 ATGACTAATTGCACACTGGCAGG - Exonic
1170611422 20:17916853-17916875 ATGTCCGATTGAAAACTGGAAGG - Intergenic
1174763951 20:53234206-53234228 ATGTTTTATTGGAAAATAGAAGG + Intronic
1177854440 21:26385240-26385262 ATGTATAAATGGACACAGGAAGG + Intergenic
1178942591 21:36918943-36918965 ATGTCTAATTGGAAACTGGAAGG + Intronic
1181599823 22:23943006-23943028 AATTCTTTTTGGAAACTGGAAGG - Intergenic
1181608684 22:23998309-23998331 AATTCTTTTTGGAAACTGGAAGG + Intergenic
949806938 3:7965760-7965782 ATGTCTAATTATACACTGAAAGG - Intergenic
950034666 3:9876882-9876904 ATGTCTGTTTGGTAACAGGAGGG - Intronic
951314525 3:21172371-21172393 ATTACAAATTGGAATCTGGAAGG + Intergenic
952046629 3:29329327-29329349 ATGTGTAATTAAAATCTGGAAGG + Intronic
953432670 3:42852590-42852612 ATGTCTAGCTGGAAGCTGCAAGG + Intronic
956737755 3:72251415-72251437 ATGTCTCTTTGGGGACTGGAAGG - Intergenic
956938148 3:74127244-74127266 ATGTCTTATTGATAACTTGAAGG + Intergenic
956955911 3:74339555-74339577 ATATGTAATTGGACACTCGATGG - Intronic
958719766 3:97829323-97829345 ATCTCTAATGTGAAACTGGGTGG + Intronic
959310540 3:104730033-104730055 ATATCTTATTGGAAATTGGAGGG - Intergenic
959493311 3:107019060-107019082 ATGTCTTATTGGAAACTGGAGGG + Intergenic
959558944 3:107757631-107757653 AAGTTTAATTAGAAACTGGGAGG - Intronic
960395392 3:117131090-117131112 ATGTCGAAGAGGAAGCTGGACGG + Intronic
963808953 3:149756110-149756132 ATATCTAATTGGGAACTCAAAGG + Intergenic
964827299 3:160842780-160842802 ATGTCTAGGTGCCAACTGGAAGG + Intronic
966257121 3:177929759-177929781 AAATCTTATTGGAAACTGGAGGG + Intergenic
967437727 3:189469219-189469241 ATGTATAGTTGGAAAAAGGAAGG - Intergenic
967713072 3:192731606-192731628 ATGTCAAAGAGGAAAGTGGACGG + Intronic
967967630 3:194974675-194974697 GGGTGTAATTGGAAACTGAATGG - Intergenic
969936036 4:10682563-10682585 TTGTGTAATTTGAAACTGGGAGG - Intronic
971016029 4:22489664-22489686 ATGTCTGTTTGGAAACTTGAAGG - Intronic
974351302 4:60750435-60750457 ATGTCTAAATTGCAAGTGGAAGG + Intergenic
975971571 4:80044709-80044731 ATTTCTAAGTGGCAACAGGAAGG + Intronic
976766337 4:88602102-88602124 ATGTATATTTGGAAACCGGCTGG + Intronic
979747134 4:124230761-124230783 GTGACAAATTGGAAACTTGAAGG - Intergenic
981636944 4:146891949-146891971 ATGTCTAAGTGGATACTGTAAGG + Intronic
982368643 4:154608640-154608662 ATGTGTAATTAGAGACTTGATGG - Exonic
983152427 4:164301253-164301275 ATGGCTAAGTAGAAACTGAAAGG + Intronic
984023351 4:174513337-174513359 ATGGCTAATTGGGAACTGCAAGG - Intronic
984024449 4:174525970-174525992 ATGTCTATTTGGAGACTTTATGG - Intergenic
987161417 5:15148099-15148121 ATGTCTGATTATAAACTAGAAGG + Intergenic
989954761 5:50344673-50344695 TTGTCTATTTGGAAAGTTGAGGG - Intergenic
990998973 5:61763968-61763990 ATCTCAAATTGGCCACTGGATGG - Intergenic
991083515 5:62626326-62626348 ATGTATATTTGGAAAATGTAGGG - Intronic
991399620 5:66239412-66239434 ATTTTTGATTGAAAACTGGAAGG + Intergenic
992643830 5:78793836-78793858 ATGTCTCAGATGAAACTGGAAGG + Intronic
992661891 5:78970175-78970197 ATGTGTAGTTGGAAAAGGGAGGG - Intronic
992949727 5:81846931-81846953 ATGTCTTCTTGGAAAATGGATGG + Intergenic
993779071 5:92042938-92042960 TTCTCTAATTGGTGACTGGAAGG + Intergenic
995940148 5:117571846-117571868 ATCACAAATTGAAAACTGGAGGG - Intergenic
996794378 5:127328671-127328693 ATTTCTAATTGGTAAATGGATGG + Intronic
1000989074 5:167893437-167893459 AAGTCTAATTGGACACAGCAGGG - Intronic
1001455941 5:171859664-171859686 ATGTCTAAGTTGAAGCTGCAAGG + Intergenic
1001609130 5:172985738-172985760 AGGGCTAAGTGGAAACAGGATGG - Intronic
1003336145 6:5174697-5174719 ACTTATAATTGGTAACTGGAAGG + Intronic
1003714496 6:8631536-8631558 ATGCTGAAGTGGAAACTGGAAGG - Intergenic
1008468661 6:51858574-51858596 ATGTCTCAGTAAAAACTGGAAGG - Intronic
1008567736 6:52786061-52786083 AAGTCTAATTTGCAACTTGATGG - Intergenic
1010742751 6:79527364-79527386 ACGTCAAAATGGAAACTGGCAGG + Intronic
1013141159 6:107336290-107336312 ATTTCTGTTTGGAGACTGGAGGG - Intronic
1014878442 6:126690689-126690711 TCCTCTAATTGGGAACTGGAAGG - Intergenic
1015625030 6:135172550-135172572 ATGACTAATTTTAAAATGGATGG + Intergenic
1016067912 6:139702947-139702969 AATTCTGATTAGAAACTGGAGGG + Intergenic
1016792380 6:148079303-148079325 CTGTCTTATAGGAGACTGGAAGG - Intergenic
1017574597 6:155788010-155788032 ATGCATAATTGGAATCTAGAAGG + Intergenic
1021806790 7:24365430-24365452 ATGTGTAATTGGAATCCAGAAGG - Intergenic
1021916045 7:25433310-25433332 ATGTTTATTTGGTAAATGGATGG + Intergenic
1022357294 7:29628151-29628173 ATGCTTCATTGGAAACTGGAAGG - Intergenic
1022749157 7:33205096-33205118 ATTTCTAAGAGGAAACTAGATGG - Intronic
1028273998 7:88828524-88828546 ATGTTTAAATTGAAAATGGATGG - Intronic
1030543953 7:110869229-110869251 ATTTTTAATTAGAAATTGGATGG - Intronic
1030589175 7:111459145-111459167 ATGTCTAGTAGGAAAATAGAGGG - Intronic
1031137582 7:117901634-117901656 TTGTCAAATGGGAAACTGGTAGG - Intergenic
1034892977 7:154856962-154856984 CTGACTAATTGGAAACTGGACGG + Intronic
1035006941 7:155670791-155670813 ATGACTAATGAGAAACAGGATGG - Intronic
1036935256 8:12995742-12995764 GGGTCTAATTGGTATCTGGATGG - Intronic
1039315360 8:36365960-36365982 GTGTCTAATTGGAAAAAAGAAGG + Intergenic
1039368402 8:36958303-36958325 ATGTGTAATTGGATACTGAATGG - Intergenic
1041987881 8:63947901-63947923 ATGATTATTTGGAAACAGGATGG - Intergenic
1042889305 8:73589724-73589746 ATGTATAAATGGAAACTCCAAGG + Intronic
1044256999 8:90075565-90075587 ATGTCAAATTGGAAAAAGAAAGG + Intronic
1045745875 8:105421367-105421389 ATGTTTAATTTGAAAGTAGAAGG + Intronic
1045930856 8:107624706-107624728 ATGTTTAAGCTGAAACTGGAAGG - Intergenic
1046893089 8:119444555-119444577 ATGTAATATTGGAACCTGGATGG + Intergenic
1046904554 8:119558564-119558586 ATGTCTAACTTGAAACTAAAAGG + Intronic
1047144018 8:122176547-122176569 ATTTCTAATTTGAAATTGTAGGG + Intergenic
1047480144 8:125274487-125274509 TTGTCTAACTGAAAACTGGTAGG - Intronic
1048455373 8:134573495-134573517 ATGTCTAACTGAAAACTACAGGG - Intronic
1056368174 9:85927359-85927381 ATGACTCATTCAAAACTGGAAGG - Intergenic
1058969833 9:110070853-110070875 ATTTCTAATTCGAAACTTGCCGG - Intronic
1203392835 Un_KI270468v1:305-327 ATGTGTAAGTGGAAACTTGGAGG + Intergenic
1186433660 X:9525262-9525284 AAGTCTAATGGGAATTTGGAAGG - Intronic
1187248552 X:17575803-17575825 ATGTCTATTTGGAAGCATGAAGG + Intronic
1189500675 X:41553644-41553666 ATATAAAATTGGAAAATGGATGG + Intronic
1190224040 X:48532107-48532129 ATATGTTATTGGAAAATGGAGGG - Intergenic
1193978361 X:88151141-88151163 ATATCTTATTAGAAACTGGAAGG - Intergenic
1194993557 X:100570183-100570205 AGGTCAAAATGGAAACTGGCAGG - Intergenic
1196693951 X:118591043-118591065 ATGTCTCTATGGAACCTGGATGG + Intronic
1199852187 X:151732661-151732683 ATGTCCAGTTGGAAGTTGGAAGG + Intergenic
1200391959 X:155953937-155953959 GTGTCTGATTGGAATCTGGTTGG + Intergenic