ID: 1178942816

View in Genome Browser
Species Human (GRCh38)
Location 21:36921556-36921578
Sequence GGCTCAGGAAAGCCTCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 339}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178942816 Original CRISPR GGCTCAGGAAAGCCTCATGG TGG Intronic
900412874 1:2520821-2520843 GGTACACGAAGGCCTCATGGGGG + Exonic
900730974 1:4259489-4259511 GCCTCAGGAAACAATCATGGTGG - Intergenic
901166224 1:7223478-7223500 GGGTCAGGAAAGCTTCATAGAGG + Intronic
902558179 1:17259473-17259495 GGCCAAGGAAAGCTTCCTGGAGG + Intronic
902727886 1:18349425-18349447 GCATCAGGAAGGCTTCATGGAGG + Intronic
902794473 1:18792223-18792245 GGCTAAGGAAGGCTTCCTGGAGG + Intergenic
903135809 1:21308563-21308585 GGCCCTGGACAGCCTCATGAAGG - Intronic
903277193 1:22229651-22229673 AGATAAGGAAAGCCTCATGCAGG - Intergenic
903448690 1:23438171-23438193 GAATCAGGAAAGGCTCCTGGAGG - Intronic
903825834 1:26145259-26145281 GTATCAGGAAAGCTTCTTGGAGG + Intergenic
903933842 1:26880910-26880932 GGGTAAGGAAAGCTTTATGGAGG - Intronic
904026840 1:27509398-27509420 CGCTCAGGAAAGACTGACGGTGG - Intergenic
904092520 1:27955394-27955416 GGATTAGGAAAGCTTCATGGGGG + Intronic
904220415 1:28963292-28963314 GGATCTGGAAAGCCTGATGAGGG + Intronic
904281015 1:29418275-29418297 GGTTCAGGAAAGCTTCATGGAGG - Intergenic
904699187 1:32348181-32348203 GGGTCAGGAAAGTCTTCTGGAGG - Intergenic
905028884 1:34868531-34868553 TGCTCAGGAGACCCTGATGGGGG - Intronic
905485485 1:38292875-38292897 GGCTAAGGAATGCTTCAGGGAGG - Intergenic
905842403 1:41193532-41193554 GGTTGAGGAAAGCTTCATGGAGG + Intronic
905953710 1:41974678-41974700 GGTTCAGGAAGGCTTCCTGGAGG - Intronic
906648195 1:47491347-47491369 GGCTTAGCAAAGCCACATGCTGG - Intergenic
906659257 1:47570999-47571021 GGGTCAGGAAAGCTTCCTGGAGG + Intergenic
906696321 1:47825721-47825743 GGTTCAGGAAATCCTCAGGGTGG + Intronic
907487089 1:54785873-54785895 GGGTCAGGGAGTCCTCATGGTGG - Intronic
907626298 1:56033526-56033548 GCTTCAGGAAAGCTCCATGGGGG - Intergenic
907650995 1:56294597-56294619 GGCTCAGGAAGGCCTTTTTGAGG - Intergenic
908337620 1:63143680-63143702 GGGTAAGGTAAGCCTCATGGTGG - Intergenic
908356910 1:63330693-63330715 GGCTCAGGAAGGCTTCGCGGAGG - Intergenic
910226429 1:84940722-84940744 GGCTGATGAATGCCTCATAGCGG + Intronic
915286603 1:154857336-154857358 GGCTGAGGAAAGTCTCCTGTGGG - Intronic
915319569 1:155048890-155048912 GAGTCAGGAAGGCCTCATGCAGG + Intronic
915515637 1:156410915-156410937 AGCTCAGGAAGGCTTCCTGGAGG - Intronic
917476878 1:175376343-175376365 GCCTCATGAATGCCTCATGATGG + Intronic
919731700 1:200916946-200916968 GGCCCAGGGAAGCCTGCTGGTGG - Intergenic
919743526 1:200994643-200994665 GGCCCTGGAGAGCCTCATGAGGG - Intronic
920825746 1:209423058-209423080 AGATCAGGACAGCTTCATGGAGG - Intergenic
921708118 1:218346858-218346880 GGCTCAGGATAGTCTTCTGGGGG - Exonic
923241967 1:232094846-232094868 GGATCAGGGAGGCCTCAGGGAGG + Intergenic
923428073 1:233891809-233891831 AGCTCATGAAAGCAGCATGGAGG + Intergenic
1063165169 10:3455226-3455248 GGCTAAGGCAGGCCTCATGTTGG + Intergenic
1063384676 10:5608680-5608702 AGCTGAGGAAGGCCCCATGGAGG + Intergenic
1066049615 10:31621567-31621589 GGCTGGGGAAAGCCTAATGAAGG - Intergenic
1069934962 10:71909036-71909058 GAGCCAGGAAGGCCTCATGGAGG + Intergenic
1071013748 10:80970305-80970327 GGGCCTGGACAGCCTCATGGAGG + Intergenic
1071467766 10:85956961-85956983 GCCTCAGGAAACAATCATGGTGG + Intronic
1072715319 10:97748275-97748297 GGCTCAGGAAGGCCTCCAGCTGG - Exonic
1073035768 10:100563173-100563195 TGCTCAGTGAAGCCCCATGGGGG + Intergenic
1074095868 10:110311961-110311983 TGCTCATGAAAGGCTCCTGGTGG + Intergenic
1076735360 10:132456584-132456606 GCCTCAGAACAGCCTCCTGGAGG - Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077614726 11:3666654-3666676 GGGTCTGGAGAGCTTCATGGTGG - Intronic
1078024821 11:7685027-7685049 GACTCAAGAAATTCTCATGGAGG + Intergenic
1078577794 11:12516440-12516462 GGCTCAGGACAGGCTTGTGGAGG - Intronic
1080527247 11:33136111-33136133 GACTCAGGAAAGCATAATGTGGG - Intronic
1081616541 11:44594785-44594807 GGCTCTGGAAAGGCTCAGGCTGG - Intronic
1082697805 11:56391544-56391566 AGGTCAGGAAAGCCTCCAGGAGG + Intergenic
1083492278 11:63021778-63021800 GGTCCAGGAAAGCCTCTCGGAGG - Intergenic
1083587477 11:63870752-63870774 GGATCAGGAAAGCTTCCTGGTGG + Intronic
1083630826 11:64094484-64094506 GGGTCAGGGAAGCTTCCTGGAGG + Intronic
1083902764 11:65651609-65651631 GGATCAGGAAGGCTTCATGGAGG + Intergenic
1083926558 11:65810743-65810765 GGCACAGGAGGGCCCCATGGTGG + Intergenic
1084022156 11:66424207-66424229 GGGTCTGGAAGGGCTCATGGAGG - Exonic
1084528557 11:69712892-69712914 GGCTGAGGAAATCCTCTTGAAGG - Intergenic
1084696787 11:70760678-70760700 GGCTCGGGAAGGCCCCATGGTGG + Intronic
1086989480 11:93287501-93287523 GCCTAAGGAAAGGCTCCTGGAGG + Intergenic
1087728494 11:101751639-101751661 TTCTAAGGAAAGCCTCATGAAGG - Intronic
1089116728 11:116101221-116101243 GGCTCAGCAAAGGCTCAGGCAGG + Intergenic
1089487766 11:118860456-118860478 GGGACAGGAAACCATCATGGTGG + Intergenic
1089538988 11:119178586-119178608 GGGTCAGGAGAGCCTCTTTGTGG + Intronic
1090865725 11:130698893-130698915 GGTCCAGGAAGGCCTCCTGGAGG + Intronic
1091075731 11:132614267-132614289 GGCTCAGGAAAATCTGATGGGGG - Intronic
1091390717 12:124708-124730 CGTCCAGGAAGGCCTCATGGAGG + Intronic
1091973770 12:4809547-4809569 GGCTCGGCAAAGACTCCTGGCGG - Exonic
1094361925 12:29640030-29640052 GGCCCCGGAATGCCCCATGGGGG - Intronic
1099593789 12:84630536-84630558 GGCTCAGGAATGCCATATTGCGG + Intergenic
1100399946 12:94220769-94220791 GGGTAAGGAAAGCTTCCTGGAGG + Intronic
1102591772 12:113961679-113961701 GAGTCAGGAAAGCTTCCTGGAGG - Intronic
1102899980 12:116628835-116628857 GGTCCAGGAAAGCCTTTTGGAGG - Intergenic
1102971173 12:117168052-117168074 GACTCATGGAATCCTCATGGAGG + Intronic
1103254405 12:119528498-119528520 GGTTAAGAAAAGCCTCATGAAGG + Intronic
1103956098 12:124577733-124577755 GGCTGGGGAAGGCCTCTTGGGGG + Intergenic
1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG + Intronic
1104564727 12:129870470-129870492 GGCTCAGCAGAGCTTCCTGGTGG + Intronic
1106400194 13:29422495-29422517 GTCATAGGAAAGCCTAATGGTGG - Intronic
1107989339 13:45803492-45803514 GGCCAAGGAAGGTCTCATGGAGG + Intronic
1109120262 13:58447683-58447705 GGCACAGGAAGGCGTCATGCAGG - Intergenic
1113744016 13:112730309-112730331 GGATCTGTGAAGCCTCATGGAGG + Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1114557991 14:23572670-23572692 AGCTCAGGAAAGCATGACGGGGG - Intronic
1115988152 14:39123988-39124010 GGCTCAGGCAATCCTCCTGCTGG + Intronic
1119116511 14:72026920-72026942 AGCTCAGGAGAGCCTCTTTGTGG + Intronic
1119130515 14:72168329-72168351 GGCTCAGGAAAGGCTCCTTCAGG + Intronic
1120669446 14:87347360-87347382 GGCTCTGAAATGCCTCAGGGAGG - Intergenic
1120720494 14:87885266-87885288 GACTCAGGAAACAATCATGGTGG + Intronic
1121219897 14:92277481-92277503 GGAGCAGGAAGGCTTCATGGAGG - Intergenic
1122629305 14:103099970-103099992 GTCTCAGGAAAGGCTCCTGATGG + Intergenic
1122859660 14:104576876-104576898 GGCTCAGGACAGCCTCAGCTGGG + Intronic
1122859668 14:104576925-104576947 GGCTCAGGACAGCCTCAGCTGGG + Intronic
1122859677 14:104576974-104576996 GGCTCAGGACAGCCTCAGCTGGG + Intronic
1122859685 14:104577023-104577045 GGCTCAGGACAGCCTCAGCTGGG + Intronic
1122969524 14:105146873-105146895 GGCTCAGGAAGGCCTCAGGCAGG - Intronic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1124034153 15:26038797-26038819 GGCCCAGCAAAGCCTGAGGGAGG - Intergenic
1124614374 15:31230944-31230966 GACTGAGCAAAGCCTCAGGGAGG + Intergenic
1124691146 15:31824251-31824273 GGCTCAGGAAGGCCTCTCTGAGG - Intronic
1127599725 15:60523534-60523556 GGCTCAGGCCAGCCACATGCTGG - Intronic
1127661802 15:61106565-61106587 GGTTAAGGAAGGCTTCATGGGGG - Intronic
1129887959 15:79051918-79051940 GGCTCATGGAGGGCTCATGGAGG + Intronic
1130305886 15:82711820-82711842 GACCCAGGAAAGCCTCAGAGAGG + Intergenic
1130540641 15:84818564-84818586 GTCTCTGGACAGCCTCTTGGAGG - Intronic
1131077035 15:89501870-89501892 GGCCAAGGAAGGCCCCATGGAGG + Intergenic
1131223891 15:90608029-90608051 GGGTCAGGCAAGCCTCGGGGAGG + Intronic
1131353783 15:91725131-91725153 GGCTCAGAAAAGTCTAATGCTGG - Intergenic
1132563835 16:611423-611445 CTCTCAGGTCAGCCTCATGGGGG + Intronic
1132649145 16:1012703-1012725 GGCTCAGGACACCATCCTGGTGG + Intergenic
1132871768 16:2118579-2118601 GGCTCAGGAAGGCCTCTCTGGGG - Intronic
1132881533 16:2163726-2163748 GGCTCAGGCAGGCCTCTAGGAGG - Intronic
1134520759 16:14918316-14918338 GGCTCAGGAAGGCCTCTCTGGGG + Intronic
1134550816 16:15137657-15137679 GGCTCAGGAAGGCCTCTCTGGGG - Intronic
1134561455 16:15213559-15213581 GGCTCAGTAATGGCCCATGGGGG - Intergenic
1134708431 16:16316967-16316989 GGCTCAGGAAGGCCTCTCTGGGG + Intergenic
1134715646 16:16357000-16357022 GGCTCAGGAAGGCCTCTCTGGGG + Intergenic
1134905806 16:17978527-17978549 GGCCAAGGAAAGCCTCACTGAGG - Intergenic
1134921993 16:18125179-18125201 GGCTCAGTAATGGCCCATGGGGG - Intergenic
1134951171 16:18351678-18351700 GGCTCAGGAAGGCCTCTCTGGGG - Intergenic
1134959111 16:18395159-18395181 GGCTCAGGAAGGCCTCTCTGGGG - Intergenic
1135590130 16:23699137-23699159 GGCTCAGGAAATCCTGCTGCAGG + Intronic
1136910679 16:34141882-34141904 GGCTCACGAAAGCCCCATGTGGG + Intergenic
1136910767 16:34142520-34142542 GGCTCACGAAAGCCCCATGTGGG - Intergenic
1137352413 16:47725063-47725085 GCCTCAGGGAAGCCTCACAGTGG + Intergenic
1140040779 16:71406219-71406241 GGCTTAGGAATTCCTCCTGGTGG - Intergenic
1141030208 16:80581134-80581156 GGATCAGGGAAGGCTCCTGGCGG + Intergenic
1141103007 16:81211612-81211634 GGCTCAGGAAAGCTTTACGGGGG - Intergenic
1141454978 16:84135372-84135394 AGGTCAGGCATGCCTCATGGAGG + Intronic
1141764207 16:86047948-86047970 GCAGCAAGAAAGCCTCATGGAGG + Intergenic
1141930253 16:87197427-87197449 GGTCCAGGAAAGCCTGGTGGTGG + Intronic
1142304560 16:89278266-89278288 GGCACAGGGATTCCTCATGGGGG - Intronic
1142365290 16:89646866-89646888 GGGGCAGGAAAGGCTCCTGGTGG - Intronic
1143112158 17:4558851-4558873 GGCTCAGGAGGGCTTCCTGGTGG - Exonic
1144362828 17:14511415-14511437 GGATCAGGAAAGCATCATCTTGG - Intergenic
1147044703 17:37744100-37744122 GGGTCTGGAAAGCCGCATGTCGG - Intronic
1147959474 17:44157715-44157737 GGCTCAGGAAAGAAACATGATGG - Intronic
1151388296 17:73768888-73768910 GGTCCAGGAAGGCTTCATGGAGG + Intergenic
1151526229 17:74670824-74670846 GGCTCAGGAGAGGCAGATGGTGG - Intronic
1151897682 17:76991315-76991337 GCCTCAGGAAACAATCATGGTGG - Intergenic
1151957869 17:77389441-77389463 AGCTGAGGAAAGCCTCATTTTGG + Intronic
1152657323 17:81526058-81526080 GGCTCTGGGCAGCCTCTTGGTGG - Intergenic
1152856528 17:82667841-82667863 AGCTCAGGAAAGCCTCGTACTGG - Intronic
1153147696 18:2052484-2052506 GGATTAGGAAAGCCTGATTGGGG - Intergenic
1153389531 18:4538601-4538623 GCCTCAGGAAACAATCATGGTGG - Intergenic
1153560728 18:6369617-6369639 TGCCCAGGAAGGCTTCATGGAGG + Intronic
1155110276 18:22707882-22707904 AGCTCAGGAGATACTCATGGAGG - Intergenic
1155980659 18:32176580-32176602 GGCTCAGGAGAGCTTTCTGGGGG - Intronic
1157114597 18:44851255-44851277 GGCCCAGGAAAGCTTCCTGTAGG + Intronic
1157812725 18:50709296-50709318 GACTCAGGAAGGCCTCAGGAAGG - Intronic
1158207648 18:55011281-55011303 GCCTCAGGAAATACACATGGTGG - Intergenic
1158660082 18:59379273-59379295 GGCTCTGGGAAGCCTTTTGGTGG + Intergenic
1160013259 18:75122640-75122662 GGCTCATGGAAGCATCATCGTGG + Intergenic
1160166877 18:76521518-76521540 GGCTCTTGAAAGCCTCCTTGAGG - Intergenic
1160490013 18:79329084-79329106 GCCTCAGGAAAGCCGCACGCAGG - Intronic
1160618419 18:80151535-80151557 GGCTCAGGCAAGCATCCTGGTGG - Intronic
1160820663 19:1056225-1056247 TGCTCAGGACAGTCTCAAGGTGG + Exonic
1163128636 19:15258210-15258232 GGCTCAGGAAACACTCCTTGAGG + Intronic
1163250281 19:16122697-16122719 TGCTCAGGAAAGACTTGTGGAGG + Intronic
1164823787 19:31269301-31269323 GGCTCCTGAAAGCCTCATCAGGG - Intergenic
1165780323 19:38429639-38429661 GACCCAGAAAAGCCTCAAGGAGG + Intergenic
1166345206 19:42161462-42161484 GGCTCAGCAAACCCTCTTTGGGG - Intronic
1167607964 19:50491571-50491593 GAAACAGGAAAGCCCCATGGAGG + Intergenic
1167660010 19:50790818-50790840 GACTCAGGAAGGCCTCGTAGCGG - Exonic
925267482 2:2576273-2576295 TGCACAGGCAACCCTCATGGAGG - Intergenic
925747498 2:7056172-7056194 GGTGGAGGAAAGCCTCATGGTGG + Intronic
928328239 2:30337002-30337024 TTCTCTGGAAAGCTTCATGGAGG - Intergenic
928939015 2:36708463-36708485 GGCTCAAGTAAGCCTCTAGGGGG + Intronic
929588072 2:43128372-43128394 CAGTCAGGAAAGCCTCCTGGAGG + Intergenic
930023089 2:47013138-47013160 GGGTCAGGGAGGCATCATGGAGG + Intronic
930641516 2:53859257-53859279 CGATCAGGAAAACCTCAGGGAGG + Intronic
932162408 2:69473566-69473588 GGCTCAGTAAAGCTTAATGGAGG - Exonic
932438168 2:71715445-71715467 GGGTCAGGAGAGCCTCTGGGTGG - Intergenic
936987230 2:118323170-118323192 GGGTCAGGGAAGCCTCCTGGAGG - Intergenic
937359210 2:121217497-121217519 GGCCCAGGATACCCTTATGGAGG + Exonic
937549568 2:123070284-123070306 GACTCAGGAAGGTCTCCTGGTGG + Intergenic
938077450 2:128347214-128347236 GGCTCAGTGAGGCCTCCTGGAGG + Intergenic
940885298 2:158984705-158984727 GGCTGGGGAAAGCTTCAGGGAGG + Intronic
943715797 2:191151066-191151088 CGCACAGGAAAGCCTCAAGTGGG - Exonic
945687192 2:212985896-212985918 TGCTCAGGAAAGAGTCCTGGGGG - Intergenic
946097055 2:217283660-217283682 GCCTTAGGAAGGCCTCATGGGGG + Intergenic
946194041 2:218022702-218022724 GGCTCTGGGAAGCAACATGGAGG + Intergenic
946307744 2:218865745-218865767 GGCCCAGGACAGTCTCCTGGGGG + Intronic
946661114 2:222000515-222000537 AGCTCAGGAGTGACTCATGGAGG - Intergenic
948377482 2:237531013-237531035 GGCTCAGGGAAGCTGCAGGGAGG + Intronic
948870245 2:240794163-240794185 GGCGCAGGGAAGCCTGACGGAGG - Intronic
948887616 2:240892050-240892072 GGCAAAGGAAAACCTCATGTAGG - Intronic
948896256 2:240929160-240929182 GGGTCAGGCAAGCTTCATGAAGG + Intronic
948988179 2:241538813-241538835 GGCCCAGGTGAGCCTCCTGGAGG + Intergenic
1169139542 20:3219375-3219397 GGCTCAAGAAAGCCTCCCGCTGG - Intronic
1169328724 20:4699386-4699408 GGCTGGGGGCAGCCTCATGGTGG + Exonic
1169328732 20:4699410-4699432 GGCTGGGGGCAGCCTCATGGTGG + Exonic
1169328749 20:4699458-4699480 GGCTGGGGACAGCCTCATGGTGG + Exonic
1170958107 20:21000359-21000381 GGCTCAGGTTATCCTCATGCAGG - Intergenic
1171388178 20:24784270-24784292 GGCTCAGGACCTCCTCCTGGTGG - Intergenic
1171527513 20:25826815-25826837 GGCTCAGGTAAGCTTCTTGTTGG - Intronic
1171545951 20:26001403-26001425 GGCTCAGGTAAGCTTCTTGTTGG + Intergenic
1171549313 20:26029069-26029091 GGCTCAGGTAAGCTTCTTGTTGG + Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171906134 20:30900590-30900612 GGCTCATGAAAGCCCCATGTGGG + Intergenic
1172189243 20:33051984-33052006 GGCTCATGAAGGCTTCCTGGAGG + Intergenic
1173191664 20:40881537-40881559 GTATGAGGAAAGCCTCTTGGGGG - Intergenic
1173479255 20:43386212-43386234 GGCTCAGGAAGTCTTCATGGAGG - Intergenic
1174776158 20:53345102-53345124 TGGTCAGGGAAGCCTCCTGGAGG + Intronic
1175113826 20:56667761-56667783 GGCTTCGGAAAGTTTCATGGAGG + Intergenic
1175298608 20:57927135-57927157 GGCCCAGGAAGGCCCCAGGGTGG - Intergenic
1175542997 20:59759908-59759930 AGTTCAGGGAAACCTCATGGGGG + Intronic
1176106967 20:63394013-63394035 CGCTCAGGGAAGCTTCATAGAGG + Intergenic
1176117778 20:63440497-63440519 GGCTCAGGACAGCCGCACGGAGG + Intronic
1177205854 21:18010355-18010377 AACTCAGGAAAGTCTCCTGGTGG + Intronic
1178942816 21:36921556-36921578 GGCTCAGGAAAGCCTCATGGTGG + Intronic
1179966638 21:44810614-44810636 GGCTCCGGCCAGCCTCCTGGAGG - Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG + Intergenic
1180743719 22:18072401-18072423 GGATCAGGAAAGACTCTGGGAGG + Intergenic
1180752141 22:18131803-18131825 TGGTCAAGACAGCCTCATGGAGG + Intronic
1181032270 22:20154372-20154394 GGCTAAGGAAGGCCTCTTGGAGG + Intergenic
1181308507 22:21930805-21930827 GGGTGAGGAAGGCCTCAGGGAGG - Intronic
1181511195 22:23389356-23389378 GGCTAAGGAAGGCCTCTTGGAGG - Intergenic
1181534551 22:23534699-23534721 GGCTCAGGAAGGCCTCTTTGAGG + Intergenic
1182127123 22:27824193-27824215 GGCTCAGGGGAGGCTCATGCGGG + Intergenic
1182501957 22:30754477-30754499 GGCTGAGGAGAGACTCATGTGGG + Intronic
1182790802 22:32951268-32951290 GGCTCAGGGAAGCCCTTTGGTGG - Intronic
1183393502 22:37559500-37559522 GGCTCAGGAAATCTTCCTAGAGG - Intergenic
1183479975 22:38058122-38058144 GGTCAAGGAAAGCTTCATGGAGG + Intronic
1183581051 22:38726988-38727010 GGGTCAGGAAGGCTTCATGCGGG - Intronic
1184242371 22:43217920-43217942 GGTTCAGGGAAGCTTCCTGGAGG - Intronic
1185235866 22:49712564-49712586 GGCTCAGAACAGCAACATGGTGG + Intergenic
1185310471 22:50151539-50151561 GGCCAAGGAAGGCCTCATGAGGG + Intronic
949360911 3:3231268-3231290 GGCTCAGGAAACAATCACGGTGG + Intergenic
951704054 3:25526094-25526116 TGATGAGGGAAGCCTCATGGAGG + Intronic
952899145 3:38098104-38098126 GGCACAGGAAATGCTGATGGGGG - Intronic
953605298 3:44409817-44409839 AGCTCAGGAAGGCCACCTGGAGG - Intergenic
955025590 3:55164399-55164421 TGCTCTGGAAAGCATCCTGGGGG + Intergenic
956264802 3:67384949-67384971 GCCTCAGGACAGCCTCAAGGTGG + Intronic
957329779 3:78746801-78746823 GGCTCAGGATGGCCTCGTGGAGG + Exonic
957486662 3:80870830-80870852 GGCTGAGGGAAGGCTAATGGTGG + Intergenic
958816031 3:98916653-98916675 GGATCTGGAAAGCTTCATAGAGG + Intergenic
958997880 3:100926857-100926879 GGCACTGGAAAGCCTCATAAAGG - Intronic
961734833 3:128994802-128994824 GGCTGGGGTAGGCCTCATGGAGG + Intronic
961927086 3:130492589-130492611 GGCTGAGGAAATTCTGATGGAGG - Intergenic
969606116 4:8203068-8203090 GGATGAGGAAACCCTCATGGGGG - Intronic
969631709 4:8342890-8342912 GGCTCAGGAGGGCCCCCTGGAGG + Intergenic
970401959 4:15725797-15725819 GGATCAGGGTAACCTCATGGAGG - Intronic
971855063 4:32032394-32032416 GCCTCAGGAAACAATCATGGCGG + Intergenic
972007762 4:34132478-34132500 GCCTCAGGAAACAATCATGGTGG - Intergenic
972516615 4:39815502-39815524 GGCTCAAGAAAGCCTGATGCAGG + Intergenic
973957435 4:56076696-56076718 GGGCCAGAAAAGCCTCCTGGAGG - Intergenic
974403226 4:61430902-61430924 AGTTCAGGAAAGCTTCAAGGTGG + Intronic
975377420 4:73661859-73661881 TCCTGAGGAAAGCTTCATGGGGG + Intergenic
976839597 4:89416383-89416405 GCCTCATGAAAGACTCATGTAGG - Intergenic
980221249 4:129919049-129919071 GGGCCAGGAAGGCCTCACGGTGG - Intergenic
982627002 4:157780061-157780083 GCCTCAGGAAACTTTCATGGTGG - Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985485756 5:147234-147256 CTGTCAGGAAAGCCTCAGGGAGG + Intronic
985581341 5:696634-696656 GGGCCTGGGAAGCCTCATGGGGG + Intergenic
985595970 5:787966-787988 GGGCCTGGGAAGCCTCATGGGGG + Intergenic
985655407 5:1129189-1129211 GGCTGAGGGAGGCCTCTTGGAGG - Intergenic
986346541 5:6840675-6840697 GGCTGAAGCATGCCTCATGGAGG - Intergenic
989225481 5:39022763-39022785 TGCTCAGGAAAGCATCTTGAGGG - Intronic
991550769 5:67833567-67833589 GGCTTTGGAATGCCTCATGTAGG + Intergenic
994044476 5:95292477-95292499 AGTTCAGGAAAGCCTCAGGGTGG - Intergenic
996783072 5:127209532-127209554 GACTCAGGATAGTCTCAAGGTGG + Intergenic
997606049 5:135176560-135176582 GGCTCTGGAGTGCATCATGGAGG + Intronic
998585044 5:143418666-143418688 GGGTCAGGGAAGGCTCCTGGAGG + Intronic
999668525 5:153937494-153937516 GGCACAGGATAGGGTCATGGTGG + Intergenic
1002966281 6:1969725-1969747 GGTCCAGGAAGGCCTCTTGGGGG - Intronic
1004226825 6:13792826-13792848 CTCTCATGAAAGCCTCTTGGGGG + Intronic
1004271428 6:14199558-14199580 GGGCCAGGAAGGCCCCATGGAGG + Intergenic
1005109209 6:22260649-22260671 GGATGGGGAAAGCCCCATGGTGG - Intergenic
1005986460 6:30878840-30878862 GACTCAGGAAGACCTCAGGGAGG - Intronic
1006439378 6:34043644-34043666 GGCTGAGGCCAGCCTCCTGGGGG - Intronic
1006643515 6:35500681-35500703 GGGTCAGGAAGGCTTCTTGGAGG - Intronic
1007633348 6:43284552-43284574 GGCTTAGGAAAAGCTGATGGGGG + Intronic
1008286622 6:49660648-49660670 GGCTCAGGAAAGCTGCCTGGGGG - Intergenic
1008300635 6:49834509-49834531 GATTCAGGAAAGCCTTAGGGTGG - Exonic
1008308463 6:49934855-49934877 GGCTCAAGAAAGCCTCTAGCAGG + Intergenic
1011416183 6:87122482-87122504 TGCCCAGGAAGGCCTCATGGCGG + Intergenic
1012601697 6:101106293-101106315 GGCTAGGGAAGGCCTCCTGGAGG + Intergenic
1014165005 6:118214263-118214285 GGTTCAGGTATGCCTCATTGTGG + Intronic
1016381147 6:143481869-143481891 GGCTCAAGCAATCCTCTTGGTGG - Intronic
1016882192 6:148922029-148922051 AGCACTGGAAAGTCTCATGGTGG + Intronic
1019257432 7:61215-61237 GGAGCAGGAAAGCCCCATGGGGG - Intergenic
1019515432 7:1437954-1437976 CGCTGAGGATAGCCTCATGGTGG - Exonic
1020629166 7:10619932-10619954 GTCTCAGGAAACTTTCATGGTGG + Intergenic
1023143900 7:37130073-37130095 AGGTCAGGAAAGCTTCCTGGAGG - Intronic
1024104148 7:46064771-46064793 GGCTTAGTGAAGTCTCATGGAGG + Intergenic
1024587197 7:50852103-50852125 GGCTGAGGGAAGCCTCCTGCAGG + Intergenic
1024691805 7:51810683-51810705 GGCTGAGGGGAGCGTCATGGAGG - Intergenic
1024992892 7:55250394-55250416 GACTCAGGACAGCCCCCTGGAGG - Intronic
1026742252 7:72986190-72986212 GTCTCAGGAAAGGCAGATGGGGG - Intergenic
1026802099 7:73406610-73406632 GTCTCAGGAAAGGCAGATGGGGG - Intergenic
1027028375 7:74870929-74870951 GTCTCAGGAAAGGCAGATGGGGG - Intergenic
1027101483 7:75378888-75378910 GTCTCAGGAAAGGCAGATGGGGG + Intergenic
1027748260 7:82106976-82106998 TTCTTAGGAAAGCCTCATGGAGG - Intronic
1028798857 7:94937865-94937887 GGCACTGGAAAGGCTAATGGAGG + Intronic
1032667399 7:134050571-134050593 TGCTCAGGATAGCTTCATAGAGG + Intronic
1033505405 7:141994831-141994853 GCCTCAGGAAACAATCATGGTGG - Intronic
1034906518 7:154952538-154952560 GTCTCAGGGAAGCTTCATGCAGG + Intronic
1034969968 7:155412824-155412846 GGCACAGGAAAGCCCCCTAGAGG + Intergenic
1035477937 7:159156935-159156957 GGCTCTGGGAAGCCTCTTAGAGG - Intergenic
1036604300 8:10292676-10292698 AGCTCAGAGAAGCCTCCTGGAGG + Intronic
1037111319 8:15167311-15167333 AGCCGAGAAAAGCCTCATGGAGG + Intronic
1037830989 8:22188916-22188938 GGCCCAGGAAGGCCACGTGGAGG + Intronic
1039109871 8:34029838-34029860 GGCTAGGGAAAGACTCATAGTGG - Intergenic
1039919686 8:41884505-41884527 GACTCAGGAAAGCTTCCTGGAGG + Intronic
1040019686 8:42729666-42729688 GGCTCCGGGAAGCGTCATGCTGG + Intronic
1040402831 8:47069846-47069868 GGCTCAGTGCAGCCACATGGTGG - Intergenic
1040572791 8:48624911-48624933 GGCACAGGGAAGCCACATGGGGG - Intergenic
1041391094 8:57348300-57348322 GGCTCAGGAAGCCATCATGCAGG + Intergenic
1043498451 8:80828830-80828852 GACTCTGGAAAGTCTCATGTTGG - Intronic
1044714480 8:95088088-95088110 GGCTGTGGACAACCTCATGGGGG - Intronic
1048296636 8:133219404-133219426 CGCTCAGCAAAGCCTGAAGGAGG - Intronic
1049196253 8:141317304-141317326 GGCTCAGCAAAGCCTCAATGGGG + Intergenic
1050423208 9:5488328-5488350 GAGTCAGGAAAGCCTCAAGTTGG + Intergenic
1052741339 9:32395607-32395629 GGCTGAGGAAGACCTCAAGGAGG + Intronic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054146350 9:61564189-61564211 GGCTCAGGTAAGCTTCTTGTTGG + Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1054466081 9:65495282-65495304 GGCTCAGGTAAGCTTCTTGTTGG + Intergenic
1054651239 9:67625712-67625734 GGCTCAGGTAAGCTTCTTGTTGG + Intergenic
1055155775 9:73061268-73061290 GGTTCTGGAAAGACACATGGGGG - Intronic
1057079402 9:92161085-92161107 GGCCCAGGAAAGCTGCAAGGAGG - Intergenic
1059345759 9:113626840-113626862 GGCATAGGAAATCCTCAGGGCGG - Intergenic
1059483789 9:114611768-114611790 GGCTCTGACAAGCCTCCTGGGGG + Intronic
1059753209 9:117268449-117268471 GATTAAGGAAAGCCTCCTGGAGG - Intronic
1060722920 9:125990257-125990279 AGCTCTGGAAGGCCACATGGAGG - Intergenic
1060802469 9:126553457-126553479 GGATCAGGGAAGGCTCCTGGGGG + Intergenic
1060933759 9:127504488-127504510 GGCCCAGGGAGGCCTCATGGAGG + Intergenic
1061077261 9:128349169-128349191 GGCTCAGGAAGGCTGCCTGGAGG - Intronic
1061245875 9:129401136-129401158 GGCTCAGGGAGGCCTCTTGGAGG - Intergenic
1061394911 9:130338465-130338487 GGCTCAGAAGGGCCTCTTGGGGG - Intronic
1061398401 9:130355592-130355614 GGCCCTGGAAGGCCTCCTGGAGG + Intronic
1061845426 9:133385469-133385491 GGCTCAGGGAAGCTGCACGGTGG - Intronic
1203759520 EBV:4882-4904 GGGCCATGAAAGCCTCCTGGCGG + Intergenic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1187089456 X:16080043-16080065 GGCTCAGAAACGCTTCATGGAGG - Intergenic
1187629679 X:21155244-21155266 GGATCAGGGAAGGTTCATGGAGG + Intergenic
1190277203 X:48906496-48906518 GCACCAGGACAGCCTCATGGAGG + Exonic
1190988263 X:55520645-55520667 AGCTAAGGAAAGCCTCATCTGGG - Intergenic
1197652265 X:129078234-129078256 GGCTCAGAAAAGCCTAAAGAAGG + Intergenic
1197972109 X:132125472-132125494 AGCTGAGGAAGGCCACATGGAGG - Intronic
1199791707 X:151161236-151161258 GGCACAGGGAAGCCACATGCAGG + Intergenic
1200712439 Y:6499649-6499671 GGCTCAGCAAACCACCATGGTGG - Intergenic
1201021476 Y:9662308-9662330 GGCTCAGCAAACCACCATGGTGG + Intergenic
1201175736 Y:11307522-11307544 GGCTCATGAAAGCCCCTTGTGGG - Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic