ID: 1178942891

View in Genome Browser
Species Human (GRCh38)
Location 21:36922468-36922490
Sequence CAGGTACAGCATGCCGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178942891_1178942896 -1 Left 1178942891 21:36922468-36922490 CCAAACTCGGCATGCTGTACCTG 0: 1
1: 0
2: 1
3: 2
4: 68
Right 1178942896 21:36922490-36922512 GGGGAGACGCAGCCATACACAGG 0: 1
1: 0
2: 0
3: 9
4: 134
1178942891_1178942898 26 Left 1178942891 21:36922468-36922490 CCAAACTCGGCATGCTGTACCTG 0: 1
1: 0
2: 1
3: 2
4: 68
Right 1178942898 21:36922517-36922539 TACAACAAAACAAACAAATTAGG 0: 1
1: 0
2: 9
3: 165
4: 1400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178942891 Original CRISPR CAGGTACAGCATGCCGAGTT TGG (reversed) Intronic
922191609 1:223323605-223323627 CAGGTACAGGATGCAGGGTGAGG + Intronic
924650208 1:245919057-245919079 CAGTTACAGTATGCCGAGGGAGG - Intronic
1068729866 10:60345101-60345123 CATGTACAGCATCCTTAGTTGGG - Intronic
1070551748 10:77495697-77495719 CAGGCACAGCCTGCCGTGCTGGG + Intronic
1090266321 11:125355421-125355443 CAGTTACAGCATGCTGAAATTGG - Intronic
1090468752 11:126959482-126959504 CAAGTATAGCATGCAGAGTGAGG - Intronic
1091055354 11:132413109-132413131 TAGGAAAAGCATGCGGAGTTGGG - Intergenic
1093449608 12:19300002-19300024 CAGGTACACCATGCAGAGAACGG - Intronic
1099645115 12:85343110-85343132 CAGGAACACAATGCCAAGTTTGG - Intergenic
1101985283 12:109441295-109441317 AAGGGACAGCAGGCTGAGTTTGG + Intronic
1106010789 13:25820116-25820138 CAGGTACAACCCGCCGAGGTTGG + Intronic
1107181912 13:37471364-37471386 CAGGTTCAGCAGGCCCAGTAGGG - Intergenic
1112624830 13:101092355-101092377 AAGATACAGCATGCCGTTTTTGG - Intronic
1112818489 13:103302052-103302074 TAGGTACAGCAAGCAGAGATGGG + Intergenic
1113665325 13:112137050-112137072 CAGCTCCAGCATGCTGAGCTAGG + Intergenic
1114731390 14:24996378-24996400 CAGGTATAGGAAGCCCAGTTAGG - Intronic
1120949082 14:90024313-90024335 CAGGTGCAGCAGGCAGAGGTGGG - Intronic
1134882640 16:17759081-17759103 CAACTACAGCCTGCCGAGTAAGG + Intergenic
1136632488 16:31497040-31497062 CAAGGACAGCATTCAGAGTTTGG - Intronic
1149570766 17:57670768-57670790 CAGGTACCACATGCAGATTTAGG - Intronic
1151595265 17:75074509-75074531 CAGGGACAGGATGCCTAGGTGGG + Intergenic
1156579723 18:38361039-38361061 CAGCTACAGTTGGCCGAGTTTGG - Intergenic
1164533815 19:29069192-29069214 CAGGTTCAGCATGCAGAGCTTGG + Intergenic
1167507758 19:49880146-49880168 AAGGTACAGCAGGCCGGGTGCGG - Intronic
926600013 2:14832355-14832377 CAGGTAGAGCAGGCTGAGTAAGG + Intergenic
930902909 2:56529711-56529733 CAGGTACAGTATTCTGACTTTGG + Intergenic
934139854 2:89035941-89035963 CAGGTACAGCAGCCAGTGTTGGG + Intergenic
934145902 2:89093706-89093728 CAGGTACAGAAGGCAGTGTTGGG + Intergenic
934223356 2:90106862-90106884 CAGGTACAGAAGGCAGTGTTGGG - Intergenic
934229386 2:90164610-90164632 CAGGTACAGCAGCCAGTGTTGGG - Intergenic
938666246 2:133540869-133540891 GAGGTGCAGCAAGCCGAGATTGG + Intronic
947521052 2:230846351-230846373 CAGGTACAGCATGACTAGTTAGG + Intergenic
948725391 2:239930847-239930869 CGGGTACAGCATGCCCAGGAGGG + Intronic
948725423 2:239930933-239930955 CGGGTACAGCATGCCCAGGAGGG + Intronic
1171135150 20:22688859-22688881 CAGGAACAGCATGCACAGATGGG - Intergenic
1172951779 20:38727076-38727098 CAGGAACAGAATGAGGAGTTGGG - Intronic
1174338810 20:49883296-49883318 CAGGGACAGCATCTCGAGATAGG + Intronic
1176037960 20:63049509-63049531 CAGGTACAAGAGGCCGAGTGCGG + Intergenic
1177690318 21:24498081-24498103 CATGTTCAGCAGGCTGAGTTGGG - Intergenic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1178969576 21:37160436-37160458 CAGGTGCAGAATGTCTAGTTTGG + Intronic
1184599204 22:45532694-45532716 CAGGTACATGAGGCCTAGTTGGG + Intronic
1184716349 22:46284288-46284310 CAGGTACACCCTGCGGAGTTGGG - Intronic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
955302789 3:57799031-57799053 CAGCTACATCATGCAGAGATGGG - Intronic
958112177 3:89162713-89162735 CAGTTCCAGCATGCAGGGTTGGG - Intronic
969618325 4:8266465-8266487 TAGGTACAGAAAGCCGAGCTAGG - Intergenic
970638387 4:18035938-18035960 CAGATACAGCATGATGAGTGGGG + Intergenic
974625742 4:64427381-64427403 CAGTTACAGGAGGCCGAGGTGGG - Intergenic
975362022 4:73481885-73481907 CAGCTAAAGCATGACCAGTTAGG + Intronic
986909742 5:12540605-12540627 CAGGTACAACATACAGTGTTTGG + Intergenic
990276409 5:54201665-54201687 CAAGTACAGCATGGGGAGGTAGG - Intronic
1000472575 5:161663845-161663867 GAGGTACAGCATGAGGTGTTAGG + Intronic
1000626826 5:163548200-163548222 CAGGTAGAAAATGCGGAGTTTGG - Intergenic
1000870661 5:166573232-166573254 CAGGCACAGAATGCTGAGTGTGG + Intergenic
1003597726 6:7489055-7489077 AAGGTACAGCATGGTGGGTTTGG - Intergenic
1005166607 6:22929348-22929370 CAGGCACAGGATTCCGTGTTGGG - Intergenic
1011305188 6:85917789-85917811 CAGTTCCAGAATGCAGAGTTAGG + Intergenic
1012487203 6:99735570-99735592 GAGGCACACCATGCAGAGTTAGG - Intergenic
1014226588 6:118855110-118855132 CAGCTACAGAATGCTGATTTTGG + Intronic
1022563021 7:31369480-31369502 CAGGCACAGGATGCCGGGTGGGG + Intergenic
1024224230 7:47313567-47313589 CAGGTACTGCATGCTGTGCTGGG - Intronic
1024493753 7:50017843-50017865 TAGGTACAGGATGCCGGGTATGG + Intronic
1033674014 7:143519932-143519954 CTGGTCCAGCATGCGGAGGTGGG - Intergenic
1043908968 8:85838193-85838215 CATGTACAACATGCCCATTTGGG - Intergenic
1055706229 9:79007819-79007841 CAGTTTCAGTATGTCGAGTTTGG - Intergenic
1057486249 9:95486798-95486820 CAGGTGCAGCATTCGGAGCTTGG - Intronic
1057956258 9:99410485-99410507 CAGGTACATCAGTCTGAGTTGGG - Intergenic
1060940601 9:127541002-127541024 CAGGTCCAGCATGGGGAGGTGGG + Intronic
1061762008 9:132857675-132857697 CAGGTACAGGATGCAGAGAAGGG + Intronic
1190620797 X:52285005-52285027 CAGCTGCAGCCTGCCGAGCTCGG - Intergenic
1201361929 Y:13161410-13161432 CAAGTACAGCCTTCCCAGTTGGG - Intergenic