ID: 1178942896

View in Genome Browser
Species Human (GRCh38)
Location 21:36922490-36922512
Sequence GGGGAGACGCAGCCATACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178942889_1178942896 16 Left 1178942889 21:36922451-36922473 CCTGGATAGCTGTGTGGCCAAAC 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1178942896 21:36922490-36922512 GGGGAGACGCAGCCATACACAGG 0: 1
1: 0
2: 0
3: 9
4: 134
1178942891_1178942896 -1 Left 1178942891 21:36922468-36922490 CCAAACTCGGCATGCTGTACCTG 0: 1
1: 0
2: 1
3: 2
4: 68
Right 1178942896 21:36922490-36922512 GGGGAGACGCAGCCATACACAGG 0: 1
1: 0
2: 0
3: 9
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178942896 Original CRISPR GGGGAGACGCAGCCATACAC AGG Intronic
900148876 1:1169676-1169698 GGGGCCACGCAGCCCTGCACTGG + Intergenic
900589372 1:3453006-3453028 GGGGAGACGAAGCCAGACCCAGG + Intergenic
900798279 1:4722716-4722738 GTGGAGATGCAGCCAGAGACTGG - Intronic
902249712 1:15146295-15146317 GGGGTGACGCAGCCTTGCAGAGG - Intergenic
902369619 1:15997579-15997601 CCGGAGACTCAGCCATAGACTGG - Intergenic
902472325 1:16657403-16657425 GGGGTGATGCAGCCATGCACGGG + Intergenic
902486478 1:16750043-16750065 GGGGTGATGCAGCCATGCACGGG - Intronic
902504313 1:16929653-16929675 GGGGTGATGCAGCCATGCACGGG - Intronic
902545282 1:17185990-17186012 GGGGAGACACAGCCCTGCCCTGG - Intergenic
902962681 1:19976036-19976058 GTGGAGACACAGCCAGGCACTGG + Intronic
906100174 1:43255296-43255318 TGGGAGACCCAGCCACACACAGG + Intronic
912971831 1:114290683-114290705 GGCGAGACGCAGCCAGATTCTGG + Intergenic
916555513 1:165891294-165891316 TGGGAGACAAAGTCATACACGGG - Exonic
922706922 1:227795027-227795049 GGGGAGGGGCAGCAACACACAGG + Intergenic
924623277 1:245680514-245680536 GGGGAGTCGCGGAAATACACAGG + Intronic
1064633923 10:17344770-17344792 GGGAAGACCCAGCCAGATACAGG + Intronic
1076120397 10:127932446-127932468 GGGGAAATGAAGACATACACAGG + Intronic
1077059744 11:612895-612917 GGGGAGGGGAGGCCATACACCGG - Intronic
1077154455 11:1085184-1085206 GGGCAGCCGCAGCCGTCCACAGG - Intergenic
1077172685 11:1174998-1175020 GGACAGATGCAGCCATCCACGGG - Intronic
1077327139 11:1968790-1968812 CGGGAGAGGCAGGCAAACACAGG + Intronic
1078371099 11:10746073-10746095 GGGGATACTCAGCCATAAAAAGG + Intergenic
1079043241 11:17077988-17078010 TGGAAGAAGCAGCCATACACAGG + Intronic
1080457127 11:32428010-32428032 GGGGTGTGGCAGCCATAGACCGG + Exonic
1081649301 11:44812964-44812986 GGGGAGCCGCACACAGACACAGG - Intronic
1083714279 11:64566990-64567012 GGGGAGATGCAGCCACAGCCTGG + Intronic
1084614709 11:70227782-70227804 GTGGACACGCAGACATACACTGG + Intergenic
1202810121 11_KI270721v1_random:23970-23992 CGGGAGAGGCAGGCAAACACAGG + Intergenic
1092166783 12:6347487-6347509 GGGTACACGCAGGCATGCACGGG - Exonic
1095727414 12:45469158-45469180 GGGCAGCCGCAGCCGTACCCGGG - Intergenic
1096180270 12:49546784-49546806 GGGGAGAAGCAGCAGGACACAGG - Intronic
1096546125 12:52341370-52341392 GGGGAGACCCCACCGTACACAGG - Intergenic
1104088552 12:125495256-125495278 GGAGGGACGCAGCCATTTACAGG - Intronic
1104088563 12:125495290-125495312 GGAGGGACGCAGCCATTTACAGG - Intronic
1115002883 14:28442771-28442793 GGGGACACTCACCCATCCACAGG + Intergenic
1115465554 14:33710623-33710645 GGGGAGACACATCCAGACAGTGG + Intronic
1118717193 14:68568909-68568931 GGGGAGAGGAAGCCATGCAGGGG - Intronic
1121523125 14:94599859-94599881 GGGGAGACCCAGCCCCACGCTGG + Intronic
1122016818 14:98803447-98803469 CGGGAGACACAGCCCAACACAGG + Intergenic
1122837455 14:104437138-104437160 GTGGAGATGCAGCCAGACAGGGG + Intergenic
1123004076 14:105313149-105313171 GGTTAGACGCTGGCATACACAGG + Exonic
1127035286 15:54908992-54909014 GGTGAGACCCAGCACTACACTGG + Intergenic
1128448176 15:67783247-67783269 GGGTAGACACAGCCAAGCACAGG + Intronic
1128743356 15:70097676-70097698 GGGGAGACGCAGCCCGAGACCGG + Exonic
1131140853 15:89975961-89975983 GGGGAAACGCAGCCAGCCCCAGG - Intergenic
1133810009 16:9154532-9154554 GGGGGGACGTGGCCATCCACCGG + Intergenic
1134621047 16:15689529-15689551 GGGGAGAGTAAGTCATACACAGG + Intronic
1142696113 17:1634852-1634874 GGGGAGCCACAGCCAGAGACTGG + Exonic
1143280056 17:5747203-5747225 GAGGATACGCAGTGATACACGGG - Intergenic
1144620115 17:16813292-16813314 GGGGTGACGCTGCCATAGAGTGG + Intergenic
1144892570 17:18502407-18502429 GGGGTGACGCTGCCATAGAGTGG - Intergenic
1145055351 17:19700003-19700025 AAGGAGAAGCAGCCAGACACAGG + Intronic
1145139644 17:20441880-20441902 GGGGTGACGCTGCCATAGAGTGG + Intergenic
1145810674 17:27762123-27762145 GGGGTGACGCTGCCATAGAGCGG - Intronic
1146123635 17:30215749-30215771 GGGGAGACACAGGCTTACCCTGG + Intronic
1147426653 17:40348913-40348935 GGGGAAATCCAGCCAGACACTGG - Intronic
1148192616 17:45690178-45690200 GGAGAGAAGCAGCCAGAAACAGG + Intergenic
1148559022 17:48595393-48595415 GCGGAGACGGAGCCATAGTCTGG - Intronic
1152004663 17:77672583-77672605 GGGAAGACAAAGCCAGACACAGG + Intergenic
1152239614 17:79154627-79154649 GGCGAGACCCAGCCAAATACTGG - Intronic
1152625883 17:81387772-81387794 GGGGAAGCGCAGACACACACTGG - Intergenic
1152630715 17:81409639-81409661 GGGGAGAGGCAGCCCTCCCCAGG - Intronic
1152661894 17:81546219-81546241 GGGCAGCCGCAGCCATCCCCTGG - Intronic
1152782779 17:82233549-82233571 TGGGAGACGCAGGCAGACCCAGG - Intronic
1154374302 18:13796530-13796552 GGGGAGTTGCAGCCATTCCCAGG + Intergenic
1154979504 18:21490991-21491013 GGGGAGAAGCAGTCAATCACTGG - Intronic
1155680026 18:28476897-28476919 GGGGACACTCACCCATTCACAGG - Intergenic
1158290240 18:55932497-55932519 GAGGAGAAGCAGCCAGACATTGG + Intergenic
1160378432 18:78430954-78430976 GGGGAGACAGAGACAGACACAGG - Intergenic
1160378452 18:78431066-78431088 GGGGAGACAGAGACAGACACAGG - Intergenic
1160378460 18:78431124-78431146 GGGGAGACAGAGACAGACACAGG - Intergenic
1160378470 18:78431184-78431206 GGGGAGACAGAGACAGACACAGG - Intergenic
1160378479 18:78431238-78431260 GGGGAGACAGAGACAGACACAGG - Intergenic
1160378489 18:78431296-78431318 GGGGAGACAGAGACAGACACAGG - Intergenic
1161864217 19:6821999-6822021 GGGGAGACACAGCCCTGCCCTGG + Intronic
1164846592 19:31437905-31437927 GGGGAGACTCAGCCAAGCTCAGG + Intergenic
1165141451 19:33702642-33702664 GTGGAGACGCAACCCAACACTGG - Intronic
1165743848 19:38218885-38218907 GGTGAGACGAAGCCATGCAGCGG + Intronic
926717057 2:15933077-15933099 GGGGAGTCGCACACACACACAGG + Intergenic
931832332 2:66065721-66065743 GGGAAGAAGTAGCCATAGACTGG + Intergenic
933966826 2:87436879-87436901 GGAGGGACACAGTCATACACAGG - Intergenic
934760302 2:96851828-96851850 GGGGAGAGGCACCCAGACAGGGG + Intronic
936562896 2:113557207-113557229 GGAGAGATGCAGCCACACCCGGG - Intergenic
936639236 2:114293544-114293566 GAGGAGAAGCAGCCACACAAAGG + Intergenic
939409459 2:141805237-141805259 GGAGAGAAGCAGCCATACTGTGG + Intronic
944129462 2:196331304-196331326 GGGCAGAGGCAGCAGTACACTGG + Intronic
947623649 2:231605892-231605914 GGAGAGACGCTGCTATTCACAGG - Intergenic
1172616288 20:36287453-36287475 GTGGATACGCAGACCTACACAGG - Intergenic
1174454984 20:50642573-50642595 GGGGAGATGGAGACATACCCTGG - Intronic
1175141064 20:56860382-56860404 GGGTGGACGCCGCCATGCACAGG - Intergenic
1175882594 20:62269532-62269554 GGGGAGACGCTGCCTTGCTCAGG - Intronic
1175949466 20:62575544-62575566 GGGGAGACCCAGTCCCACACGGG + Intergenic
1178942896 21:36922490-36922512 GGGGAGACGCAGCCATACACAGG + Intronic
1182435173 22:30325836-30325858 GAGGAGGCGCATACATACACAGG + Intronic
1183935858 22:41261822-41261844 GGGGAGACCAAGCCCTACTCAGG + Intronic
1185361974 22:50413802-50413824 GGGTAGACCCAGCCCTCCACTGG - Intronic
949187595 3:1211430-1211452 GAGGAAAAGCAGCCAAACACTGG + Intronic
949274209 3:2259013-2259035 GAGGAGACGAAGACATACAGAGG + Intronic
953046086 3:39295049-39295071 GGGGTAAGGCAGCCAGACACAGG + Intergenic
956534448 3:70260277-70260299 GGGAAGACACAGACACACACAGG - Intergenic
960157257 3:114308698-114308720 GGAGAGAAGGAGACATACACAGG + Exonic
960997008 3:123346884-123346906 GGGGACACGAAGCGATACAGTGG - Intronic
961458800 3:127037475-127037497 TGGGAGACTCAGCCACACCCAGG + Intergenic
962813991 3:138982242-138982264 GGGGAGATGCTGGCATACACTGG + Intergenic
967674583 3:192281333-192281355 GGAGAGATGCAGAGATACACAGG - Intronic
971076081 4:23151511-23151533 GGGGAGAAGCAGCTGGACACTGG + Intergenic
986262593 5:6161419-6161441 GGGAAGACGCCGCGATACTCAGG - Intergenic
988734469 5:34007203-34007225 CGGCAGACGCTGGCATACACAGG - Intronic
998312836 5:141152146-141152168 AGCGAGACGCAGCCAAGCACAGG + Exonic
999256161 5:150210991-150211013 GGGGGGACGCAGCGAGAGACAGG - Exonic
1001038431 5:168314757-168314779 GGGGACAAGGAGCCATTCACGGG + Intronic
1003385963 6:5667753-5667775 GTGGAGACCCAGCCATGCAAAGG + Intronic
1005078957 6:21937640-21937662 GGGGCGACGAAGACATACTCTGG - Intergenic
1005909225 6:30293711-30293733 GTGGGGATGCAGCGATACACAGG + Intergenic
1010569952 6:77464070-77464092 GCGGAGACGGAGCCATAAAAGGG + Intergenic
1012607668 6:101177988-101178010 GGAGAGATGGAGCCATAAACAGG + Intergenic
1017776679 6:157686275-157686297 GGGGAGCCCCAACCTTACACTGG + Intergenic
1018237081 6:161737024-161737046 GGGGAGGCGGAGGCATTCACAGG + Intronic
1019213562 6:170424965-170424987 GCGGAGACTCAGCCGTGCACAGG - Intergenic
1022533005 7:31078788-31078810 GGGGAGAGGGTGCCACACACGGG + Intronic
1024032516 7:45475318-45475340 TGAGAAAAGCAGCCATACACTGG + Intergenic
1025040934 7:55645244-55645266 GGGAAGATGCGGCTATACACTGG + Intergenic
1025750454 7:64289380-64289402 GGGGAGACACAGCCTCACAAGGG + Intergenic
1026830587 7:73607630-73607652 GGGGTCACGAAGCCACACACGGG + Exonic
1030688745 7:112511661-112511683 GTGAAGAGGCAGACATACACGGG - Intergenic
1034968509 7:155405597-155405619 GGGGAGACGCAGCCGGTCCCTGG + Intergenic
1035355394 7:158273500-158273522 GGGGAGCCGCAGACAGACATGGG + Intronic
1035355413 7:158273574-158273596 GGGGAGCCGCAGACAGACATGGG + Intronic
1035355427 7:158273629-158273651 GGGGAGCCGCAGACAGACATGGG + Intronic
1035355549 7:158274206-158274228 GGGGAGCCGCAGACAGACATGGG + Intronic
1035355599 7:158274414-158274436 GGGGAGCCGCAGACAGACATGGG + Intronic
1037762098 8:21748285-21748307 GGGGAGATGGAGCCATTCAGTGG - Intronic
1040296209 8:46150423-46150445 GGGGAGAAGCGGCAAGACACGGG - Intergenic
1046811418 8:118537694-118537716 GAGGAAACTCAGCCATATACAGG - Intronic
1048330143 8:133465657-133465679 GCAGAGAGGAAGCCATACACGGG - Intronic
1048525932 8:135202460-135202482 GGGGAGACGGAGACATAAAGAGG - Intergenic
1058705757 9:107637045-107637067 GGGGAGATGGAGCCACACATGGG - Intergenic
1059457126 9:114406624-114406646 GGGGAGACGGAGGCATAGATGGG + Exonic
1061230755 9:129314481-129314503 GGGCACACGCTGCCATCCACAGG + Intergenic
1061479279 9:130888622-130888644 TGGGAGAAGCAGCCATTCAAAGG - Intergenic
1061488088 9:130930406-130930428 GGGGAGACGCGGGGAGACACGGG + Intronic
1061488099 9:130930446-130930468 GGGGAGACGCAGGGAGACGCGGG + Intronic
1189772248 X:44438183-44438205 GGGGACACAGAGCCAAACACAGG - Intergenic
1197754015 X:129982660-129982682 GGAGAGACAGAGCCACACACTGG - Intronic