ID: 1178943268

View in Genome Browser
Species Human (GRCh38)
Location 21:36925363-36925385
Sequence GGCCACGATGAACACCCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178943261_1178943268 26 Left 1178943261 21:36925314-36925336 CCAGCCGGCTTGTGTTTCTCAGG 0: 1
1: 0
2: 0
3: 12
4: 238
Right 1178943268 21:36925363-36925385 GGCCACGATGAACACCCACAAGG 0: 1
1: 0
2: 0
3: 3
4: 76
1178943264_1178943268 0 Left 1178943264 21:36925340-36925362 CCTACACACTGTTAGCCACCGTT 0: 1
1: 0
2: 1
3: 3
4: 85
Right 1178943268 21:36925363-36925385 GGCCACGATGAACACCCACAAGG 0: 1
1: 0
2: 0
3: 3
4: 76
1178943263_1178943268 22 Left 1178943263 21:36925318-36925340 CCGGCTTGTGTTTCTCAGGTCAC 0: 1
1: 0
2: 1
3: 12
4: 155
Right 1178943268 21:36925363-36925385 GGCCACGATGAACACCCACAAGG 0: 1
1: 0
2: 0
3: 3
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178943268 Original CRISPR GGCCACGATGAACACCCACA AGG Intronic
900375491 1:2352616-2352638 GCCCACTAGGAACACCCACCTGG - Intronic
900821430 1:4892344-4892366 CCCCAGGATGAACACACACAAGG + Intergenic
912552535 1:110493473-110493495 GGCCATGAGGAAGACCAACAGGG - Intergenic
913532616 1:119743407-119743429 GGCCACCAGGGACAGCCACAGGG - Intronic
915754618 1:158248063-158248085 AGTCAAGATGAACCCCCACATGG - Intergenic
916382529 1:164228249-164228271 GGTCACTCTGAACATCCACAGGG + Intergenic
1065053688 10:21820963-21820985 GGCCTCCATAAAAACCCACAAGG - Intronic
1065797300 10:29319253-29319275 GCCCACCATGAAGACCAACATGG + Intergenic
1066268380 10:33798269-33798291 GGCAGCGATGAACATCCAGATGG + Intergenic
1069747366 10:70724349-70724371 GGCTACGAGGCACACCCACAGGG - Intronic
1070355454 10:75635560-75635582 GGCCACAACCATCACCCACAAGG + Intronic
1070826716 10:79394481-79394503 GGCCAAGATGATGCCCCACAGGG + Intronic
1073001325 10:100288172-100288194 AGCCACCATGGAAACCCACATGG + Exonic
1078923820 11:15856801-15856823 GGCCATGCTGACCACCCATAGGG + Intergenic
1079726347 11:23884875-23884897 AGCCACCAAGAAAACCCACAAGG - Intergenic
1081880896 11:46450726-46450748 AGCCACCATGTACAGCCACAAGG + Intronic
1082301047 11:50506747-50506769 GGCCTCAATGAACTCCCAAATGG + Intergenic
1083458420 11:62794744-62794766 AGCCAGGATGAAAACCCAGACGG + Intronic
1085025582 11:73234626-73234648 GGCCAGCACCAACACCCACACGG - Exonic
1085207927 11:74748237-74748259 AGCCTAGAGGAACACCCACATGG + Intergenic
1087505376 11:99013853-99013875 TGCCAAGAAGAACACGCACAAGG + Intergenic
1093892101 12:24534631-24534653 CCCCAAGATGAACACCTACATGG + Intergenic
1104073021 12:125363053-125363075 TGCCACGTTGAACACAAACAAGG + Intronic
1104914753 12:132258847-132258869 GTCCACGCTGGAGACCCACAGGG + Intronic
1105431718 13:20343193-20343215 GGCCAGGATGGAGGCCCACAGGG - Intergenic
1114483357 14:23048457-23048479 GGCCACGAAGAGCACCACCAGGG + Exonic
1118627691 14:67674410-67674432 GGCCTCCATGAAGACCTACAAGG - Exonic
1124874573 15:33579907-33579929 GGCCCTGATGAACACCCACTGGG - Intronic
1127350430 15:58146675-58146697 GGCCACGTGGAATTCCCACAGGG - Intronic
1129761146 15:78130126-78130148 GGGCAGGAGGAACACCAACAGGG - Intronic
1131237938 15:90713267-90713289 GGCCCTGAAGAACACCCTCATGG + Intergenic
1132593555 16:737642-737664 GGCCCCGGTGCACACTCACAGGG + Intronic
1141204433 16:81922791-81922813 GGCATAAATGAACACCCACACGG - Intronic
1143497601 17:7321429-7321451 CCCCCCGACGAACACCCACACGG + Exonic
1148999083 17:51738637-51738659 AGCCATGATGAGCATCCACAAGG - Intronic
1152491967 17:80641060-80641082 GGCCACGAAGTACACAAACAAGG - Intronic
1154235310 18:12600019-12600041 GGCCACGTTGGGAACCCACATGG + Intronic
1160034486 18:75287657-75287679 GTCCATCATGAACACCCACCTGG + Exonic
1162745673 19:12796719-12796741 GGCGAAGATGAGCAACCACAGGG + Intronic
1165109997 19:33496800-33496822 GGGGAGGATGTACACCCACAGGG - Intronic
1165879424 19:39032012-39032034 GGCCAGGATCAGCAGCCACAGGG + Exonic
1167577230 19:50323564-50323586 GGCGAAGATGAGCACCCCCAGGG + Exonic
926152171 2:10431406-10431428 GGCCACGATGAACCCCTAGTAGG + Intergenic
926192390 2:10738589-10738611 GGCTGCGATGAGCACCAACACGG - Intronic
927429394 2:23014187-23014209 GGCCATGATGCACAGACACAGGG - Intergenic
929354386 2:41002033-41002055 GACCACCAGGAACACACACAGGG + Intergenic
940080975 2:149800885-149800907 GGTCAGGATGAACACCCAACTGG - Intergenic
1175240359 20:57543086-57543108 GGCCACTATGAACAAGCACCTGG + Intergenic
1176876114 21:14130810-14130832 AGCCACCAGGAACACCAACATGG + Intronic
1177212347 21:18086972-18086994 AGCTACCAGGAACACCCACATGG - Intronic
1178943268 21:36925363-36925385 GGCCACGATGAACACCCACAAGG + Intronic
1179431260 21:41322828-41322850 GGCCGGGATGAAAAGCCACAGGG + Intronic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
1183095816 22:35551747-35551769 GGCCAAGAAGAACACCAACGTGG + Exonic
950959884 3:17094374-17094396 GGCCCCGTTAAACACCCTCATGG - Intergenic
952969883 3:38644149-38644171 GGCCACAATGACCTCCCACCAGG + Intronic
956776193 3:72567555-72567577 GCTCTCCATGAACACCCACACGG + Intergenic
957240965 3:77660876-77660898 GGCCACCATGAAAAGCCCCAGGG + Intergenic
958932782 3:100225431-100225453 GGCCTCCATGAAGACCTACAAGG + Intergenic
986261790 5:6153808-6153830 GACCAAGATCAAAACCCACATGG - Intergenic
990363634 5:55047286-55047308 AGCCTCCATCAACACCCACAGGG + Intergenic
993310946 5:86331302-86331324 TGCCACGAGGAGCTCCCACAAGG + Intergenic
995462119 5:112414517-112414539 GGACAGGATAAACTCCCACAGGG + Intronic
1007739038 6:44000097-44000119 GCCCTTCATGAACACCCACATGG - Intergenic
1008030410 6:46688172-46688194 GTCCACGAAGGACACCCGCAGGG - Exonic
1027187131 7:75979380-75979402 GGCTCCGGTGAACACCCACTGGG - Intronic
1033079342 7:138280139-138280161 GGACAAGATGAACAGCCAGATGG - Intergenic
1034465525 7:151226453-151226475 GGGCATGATGATGACCCACAGGG + Exonic
1038360345 8:26869207-26869229 GGAGACAATGAACCCCCACAAGG + Intergenic
1053384599 9:37676907-37676929 TAACACGATGAACACCCAAAGGG + Intronic
1056262368 9:84861929-84861951 GGCCAGGATGAACAAGCATAGGG - Intronic
1056293522 9:85168352-85168374 GGGCAGGATGAAAAGCCACAGGG + Intergenic
1056926926 9:90843278-90843300 GGCCACGTTGAGGGCCCACACGG - Intronic
1186680694 X:11870589-11870611 GGGCACTATGAAGACCCAAAAGG - Intergenic
1186786321 X:12959404-12959426 GGCCAAGAAGAACAACCACAAGG - Intergenic
1188916640 X:35919793-35919815 GGCAGCCATGAACACCCAAAAGG + Exonic
1192351536 X:70360494-70360516 GGCCACAAGGACCACCCACGTGG - Intronic
1193607444 X:83585614-83585636 GGCCACAATTAACAGACACAGGG + Intergenic
1196026062 X:111042515-111042537 GGCTATGTTGCACACCCACAAGG + Intronic
1200205225 X:154310786-154310808 GGCCCAGATGATCCCCCACAGGG + Intronic