ID: 1178943532

View in Genome Browser
Species Human (GRCh38)
Location 21:36927205-36927227
Sequence GCTGAGATGCAGGCTGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 456}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178943532_1178943541 21 Left 1178943532 21:36927205-36927227 CCGCCCACAGCCTGCATCTCAGC 0: 1
1: 0
2: 5
3: 47
4: 456
Right 1178943541 21:36927249-36927271 ATCGTGCACAGTGACACTGATGG 0: 1
1: 0
2: 1
3: 4
4: 95
1178943532_1178943536 -3 Left 1178943532 21:36927205-36927227 CCGCCCACAGCCTGCATCTCAGC 0: 1
1: 0
2: 5
3: 47
4: 456
Right 1178943536 21:36927225-36927247 AGCCAAGCCCTGCTTCCTCTTGG 0: 1
1: 0
2: 5
3: 32
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178943532 Original CRISPR GCTGAGATGCAGGCTGTGGG CGG (reversed) Intronic
900512387 1:3066826-3066848 GCTGGGCTGCAGGGTGAGGGTGG + Intergenic
901250360 1:7772964-7772986 ACTGGGATGCAGGGAGTGGGTGG - Intronic
901430199 1:9209515-9209537 GCTGTCATGCGGGCTGTGGGAGG - Intergenic
901465146 1:9416675-9416697 AGTGAGACGCAGGCTGAGGGTGG + Intergenic
901828904 1:11880252-11880274 GCGGAGGTGGAGGCTGTGGCAGG + Intergenic
902441101 1:16430569-16430591 GCTGGGCTGGAGGCTGTGAGGGG + Intronic
902614883 1:17618386-17618408 GCTGCGAGGCAGGCTGGGGTGGG + Intronic
902916494 1:19643227-19643249 GCGCAGATGCAGGCTGGGTGTGG + Exonic
903126963 1:21254870-21254892 GCGGAGATGCAGGCCGTGCTAGG - Intronic
903127436 1:21257488-21257510 GCTGGGAGGCAGGCTGGGAGGGG + Intronic
903930882 1:26861898-26861920 TCTGAGAAACAGGCTGGGGGAGG + Intergenic
904327682 1:29738218-29738240 GCTGAGATGCATGCTGGGGATGG - Intergenic
904492401 1:30869238-30869260 GCTGGGATGGGGGCTGTGGTTGG - Intergenic
904521535 1:31099784-31099806 GGTCAGAAGCAGGCTGTTGGAGG + Intergenic
905318064 1:37096201-37096223 GCTGGGAGGCTGGCTGTGTGCGG + Intergenic
905399586 1:37691927-37691949 GCAGGGGTGCAGGCTTTGGGGGG - Intronic
905671804 1:39795876-39795898 GCTGAGAACCAGGCTGTGTGTGG - Intergenic
905790562 1:40787045-40787067 CCAGAGACGCAGGCTGTGGCAGG + Intronic
906794381 1:48685449-48685471 CCTGAGATGATGGCTATGGGGGG - Intronic
907282912 1:53362612-53362634 GCTGTGAGGGAGGCAGTGGGAGG - Intergenic
910446452 1:87303169-87303191 GCTCAGTGGCAGGTTGTGGGAGG - Intergenic
912370102 1:109167259-109167281 TCAGAGAGGCAGGATGTGGGTGG + Intronic
912509687 1:110180451-110180473 GCTGAGAAGGAAGCTCTGGGGGG + Intronic
912730324 1:112096597-112096619 ACTGAGAGGCAGGAAGTGGGCGG + Intergenic
912771265 1:112466014-112466036 GCTGAGATGGAGGGTGGCGGAGG - Intergenic
913105930 1:115613934-115613956 GATGAGGTGGAGGCTGAGGGTGG - Intergenic
913257062 1:116963309-116963331 GCTGAGAGAGAAGCTGTGGGAGG - Intronic
913392828 1:118333610-118333632 GCTTAGAGTCAGGCTGTTGGTGG + Intergenic
915754597 1:158247838-158247860 GCTGAGATAAAGGCTAAGGGAGG + Intergenic
915955876 1:160219495-160219517 GCTGAGTTGCAGGGAGTGGTGGG + Intronic
917444571 1:175096180-175096202 GGGGTCATGCAGGCTGTGGGAGG + Intronic
917522263 1:175757923-175757945 GCCGAGCTGCAGGATGGGGGTGG + Intergenic
919936069 1:202251725-202251747 GCTGAGAGGCAGGCTAGTGGGGG - Intronic
920345458 1:205303347-205303369 GCTGGGATGCAGGTCCTGGGAGG + Exonic
920727182 1:208447060-208447082 TCAGAGAAGCAAGCTGTGGGAGG - Intergenic
920943899 1:210510455-210510477 GCTGAGACGGAGGAGGTGGGCGG + Intronic
922964177 1:229674270-229674292 GGGGAGAGGGAGGCTGTGGGCGG - Intergenic
923552915 1:234978517-234978539 CCTGAGATGCTGCCTGTAGGGGG - Intergenic
924515158 1:244759922-244759944 CCTGAGATGCAGGCTGGGCGCGG + Intergenic
924586505 1:245365516-245365538 GCTGAGCTGTAGGCTGGTGGGGG - Intronic
1063016835 10:2086830-2086852 ACTCAGATGCAGACTGTGGGAGG - Intergenic
1063048922 10:2424242-2424264 GCTGGCATTCTGGCTGTGGGCGG + Intergenic
1063477339 10:6340642-6340664 GCAGAGATGAAGGGAGTGGGTGG + Intergenic
1065078326 10:22102951-22102973 GGGGAGATGCGGGCTGGGGGTGG + Intergenic
1065102066 10:22340928-22340950 GCCGAGATGCGGGCGGTGGAGGG - Intergenic
1065706574 10:28476342-28476364 GGTGAGAGGCAGGCAGTGGAGGG + Intergenic
1065970010 10:30798725-30798747 GGTGAGATGCAGGCCTTGCGGGG + Intergenic
1067094137 10:43287215-43287237 GCTGTGCTGCAGGCTCTGGGAGG + Intergenic
1067116210 10:43437214-43437236 GCCGAGGTGCGGGCTGTGAGAGG + Exonic
1067432069 10:46251466-46251488 GCAGAGATGGAGGCTGGGGCGGG - Intergenic
1067782565 10:49219538-49219560 GCTGAGAGGAGAGCTGTGGGGGG - Intergenic
1068522052 10:58087655-58087677 GCAGAGATGGAGGATGTGGAAGG - Intergenic
1069569850 10:69487740-69487762 GCTGAGATGAAGGCTTTGGCTGG + Intronic
1069796158 10:71053219-71053241 GCTGAGATGAGGGCTGAGGGTGG + Intergenic
1069884087 10:71612623-71612645 GCTGGGATGCTGTCTGTGGGGGG + Intronic
1070793636 10:79204292-79204314 GCTTAGATAGAGGCTGTGAGGGG - Intronic
1070816465 10:79327695-79327717 GAAGAGATGGAAGCTGTGGGAGG + Intergenic
1070916768 10:80160083-80160105 GCTGAGACTCAGGCTGGGGAAGG - Intronic
1071012604 10:80955592-80955614 CCTGAGATTCAAGCTGTGGGTGG - Intergenic
1071785215 10:88892084-88892106 TTTGAGATGCAGGGTGAGGGAGG + Intronic
1072118419 10:92385415-92385437 GTTAAGATGCAGGCTCTGGCTGG - Intergenic
1072226326 10:93373265-93373287 GCTGGGAGGCAGACTGTGGCTGG + Intronic
1075069510 10:119311449-119311471 CCTGAGATGGGGGCAGTGGGTGG + Intronic
1076205681 10:128599554-128599576 GCTGAGGTGGAGGCGGTGGTGGG - Intergenic
1076498692 10:130917121-130917143 GCTGAAATGCAGGTGGTGGCAGG - Intergenic
1076615216 10:131750410-131750432 GCCCAGGTGCAGGCCGTGGGAGG - Intergenic
1076869499 10:133186422-133186444 GCCCAAATGCAGGCTGTGGCCGG + Exonic
1077112151 11:866632-866654 GCAGAGAAGCGGGCGGTGGGCGG - Exonic
1077230867 11:1457656-1457678 GCTGAGATGCAGGCTGGGAGAGG - Intronic
1077490269 11:2857893-2857915 GCTGAGATGAGGGCTGGGGCCGG - Intergenic
1081631144 11:44690813-44690835 GCTGAGATGCAGGTTCTGCCAGG + Intergenic
1083343123 11:61971833-61971855 GCTGAGCTGGAGGGTGGGGGAGG - Intergenic
1083390610 11:62347127-62347149 GCTGATATACAGGTTGTGGAGGG - Intronic
1083840577 11:65302017-65302039 GCTGTCAGGCAGGCTCTGGGTGG - Intronic
1084167355 11:67381863-67381885 GCTGAGCTGGAGGCTGGAGGAGG - Intronic
1084735775 11:71104362-71104384 TCAGAGATGCAGGATGGGGGGGG - Intronic
1084736396 11:71108390-71108412 GCTGTGGGGCAGGCAGTGGGAGG - Intronic
1085730647 11:78995746-78995768 GATGAGATGCAGAGTGAGGGTGG + Intronic
1088162274 11:106886942-106886964 GCAGAGATGCAGGGTGAGGCTGG - Intronic
1088607562 11:111546033-111546055 GCAGAGATGAAGGCTATGGATGG - Intronic
1088722543 11:112607179-112607201 GTAGAGATTCAGGCAGTGGGTGG + Intergenic
1089063324 11:115643693-115643715 GCTGAGCTCCAGGCTCTGGCCGG - Intergenic
1089157049 11:116410542-116410564 GCAGAGATGGAGCCTGGGGGAGG - Intergenic
1089812237 11:121141608-121141630 GCTGCGATGAAGCCTGAGGGTGG - Intronic
1090075205 11:123576247-123576269 GCTGGGATGCAGCCTGCAGGGGG + Intronic
1090158369 11:124465341-124465363 TCCTAGATGCAGGCTGGGGGTGG - Intergenic
1090357029 11:126147113-126147135 GCTGCGGGTCAGGCTGTGGGTGG - Intergenic
1090400860 11:126447419-126447441 TCTGAGATGCAGGGTGATGGAGG + Intronic
1090464044 11:126917579-126917601 GCTCAGTTGTAGGCTGTGTGGGG + Intronic
1090908409 11:131097057-131097079 GCTGAGCAGGAGGCTGAGGGAGG - Intergenic
1090915713 11:131160377-131160399 GCTGGGATGCTGGCTGGGGAAGG + Intergenic
1091309550 11:134562860-134562882 ACTGAGCCCCAGGCTGTGGGTGG + Intergenic
1091617285 12:2059219-2059241 GCTGAGATGCAGAAGGTGAGGGG + Intronic
1091680293 12:2522149-2522171 CCTGAGATGGGGGCTCTGGGAGG - Intronic
1091747837 12:3003908-3003930 GCTGAGGTGGTGGCGGTGGGAGG - Intronic
1093688444 12:22082821-22082843 GTTGAGAAGCAGGCTTGGGGAGG - Intronic
1095977157 12:47947540-47947562 GCTGGGGCTCAGGCTGTGGGAGG + Intergenic
1096344599 12:50834442-50834464 GCTGAGGGGCAGGGTGGGGGAGG + Intergenic
1101830402 12:108252409-108252431 GCTAAGAGGCAGGCAGTGGCTGG + Intergenic
1102636230 12:114326625-114326647 GCCAAGGTGCAGGCTGTGGCGGG - Intergenic
1102703739 12:114863232-114863254 GCTCAGATGCAGGCAGTATGGGG + Intergenic
1102923885 12:116812335-116812357 GCAGAGATGCAGGCAGAGGACGG + Intronic
1102947227 12:117000264-117000286 TATGAGATGCAGGCTGGGTGCGG - Intronic
1103165049 12:118763314-118763336 GCTGAGATGGGGGCTGAGAGGGG - Intergenic
1103308775 12:119988788-119988810 GGTGAGCAGCAGGCGGTGGGCGG + Intergenic
1103432955 12:120903885-120903907 GCTCCGCTGCAGGCTGTGGCCGG + Exonic
1103889709 12:124229050-124229072 TCTGAGAGGCAGGCTCTGGCTGG + Intronic
1103950636 12:124549261-124549283 GCTGAGGGGCTGGCGGTGGGAGG + Intronic
1104758123 12:131281475-131281497 AGAGAGATGCAGGCTTTGGGAGG + Intergenic
1104948653 12:132428795-132428817 GCTGAGCTGCAGGCTGAAGTCGG + Intergenic
1104973986 12:132543904-132543926 GCTGAGCTGCGGGCTTGGGGTGG + Intronic
1105302914 13:19151674-19151696 GCTCAGAAGCAGGCTGGAGGCGG + Intergenic
1105438329 13:20395892-20395914 GGAGAGATCCAGGCTGTGGCTGG - Intergenic
1105657819 13:22459425-22459447 GCTGAGAGTGAGGCAGTGGGAGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105805857 13:23951264-23951286 GCAGGGAAGGAGGCTGTGGGAGG - Intergenic
1106799787 13:33244188-33244210 GCTGAAAATCAGGATGTGGGAGG + Intronic
1108051121 13:46440362-46440384 GCTGAGCTGCAGGCTGAGCGTGG - Intergenic
1108290434 13:48954941-48954963 GCTGAAAAGGAGGCTGTGGAAGG - Intergenic
1109543679 13:63813983-63814005 GCTGAGCTGCAGGCTGAGTGTGG - Intergenic
1111909890 13:94299483-94299505 TTGGAGATGGAGGCTGTGGGAGG + Intronic
1112330368 13:98472893-98472915 GTTGAGATGCAAGCTGAGAGAGG - Intronic
1112484767 13:99810427-99810449 GCAGAGAGAGAGGCTGTGGGTGG + Intronic
1112498819 13:99926574-99926596 GCAGAGACGCGGGCTGTGCGGGG - Intergenic
1112751023 13:102583361-102583383 GGTGAGATGGAGGGTGTGAGGGG + Intergenic
1118312572 14:64704560-64704582 GCTGAGGGGCTGGCGGTGGGCGG + Exonic
1119422940 14:74518360-74518382 GATGAGAAGCAGGCTGGGGCCGG - Intronic
1119543725 14:75457073-75457095 CATGAGATGCGGGCTGAGGGTGG - Intronic
1119871863 14:78024594-78024616 GCTGTGCTGCAGGCTATAGGTGG + Intergenic
1121404773 14:93712982-93713004 GTGGGGATGCAGGGTGTGGGGGG + Intergenic
1121528823 14:94638414-94638436 GGTGAGTTGGGGGCTGTGGGTGG + Intergenic
1122238826 14:100348423-100348445 GCTGAGTTTCAGGCCCTGGGGGG + Intronic
1122405500 14:101498422-101498444 GCTGAGATGGAGACGGTGCGAGG - Intergenic
1122625899 14:103085241-103085263 GCTGGCATGCAGGCAGTAGGGGG - Intergenic
1122638439 14:103141922-103141944 GCTGAGGTCCCGGCTGAGGGAGG - Intergenic
1122641211 14:103160733-103160755 GTTGGGGTGCAGGCTGTGGGGGG - Intergenic
1122641265 14:103160891-103160913 ATTGAGGTGCAGGCTGTGGGGGG - Intergenic
1122787557 14:104171004-104171026 GCTGGGGGGCAGGCTGAGGGTGG - Intronic
1122854758 14:104554720-104554742 CCTGCAATGCTGGCTGTGGGTGG + Intronic
1122924303 14:104892638-104892660 GCTGTGATGCTGGCCCTGGGGGG + Intronic
1202829227 14_GL000009v2_random:8231-8253 GGAGAGATGCAGGCTTTGGCTGG + Intergenic
1123458018 15:20443645-20443667 GTGGAGATCCAGGTTGTGGGAGG - Intergenic
1123660050 15:22556764-22556786 GTGGAGATCCAGGTTGTGGGAGG + Intergenic
1123941048 15:25216809-25216831 GCTCAGGTGCTGGCTCTGGGAGG + Intergenic
1123966728 15:25467024-25467046 TCAGAGATGCAGGATGTGTGAGG + Intergenic
1124313911 15:28651259-28651281 GTGGAGATCCAGGTTGTGGGAGG + Intergenic
1125111336 15:36038398-36038420 GCGGTGATGAAGGGTGTGGGAGG + Intergenic
1125897485 15:43314958-43314980 GCTGACATGCTGACTTTGGGTGG - Intergenic
1127130328 15:55855592-55855614 GCTGCCATCCAGGCTGTGGCTGG + Intronic
1128170293 15:65505372-65505394 TCTGAGCAGTAGGCTGTGGGGGG + Intronic
1128708417 15:69854018-69854040 GCTGAGAGCCTGGATGTGGGTGG - Intergenic
1129924332 15:79349420-79349442 GTTGGGAGACAGGCTGTGGGTGG + Intronic
1130520766 15:84658947-84658969 ACTGTGATGCTGGCTGTGAGAGG - Intergenic
1131070066 15:89460627-89460649 GCTGAGATGAAGGATGGGGTAGG - Intergenic
1131112845 15:89776334-89776356 GCCGGGCTGCAGGCTCTGGGAGG - Intronic
1131567378 15:93498627-93498649 CCTGAGATTCAAGCTGTGGGTGG - Intergenic
1131862418 15:96668043-96668065 GATAAGATGCAGGCTGGGTGTGG + Intergenic
1132366904 15:101264446-101264468 GCTGAGATGAAGGGATTGGGAGG - Intergenic
1132598868 16:765137-765159 GCTGATGTGCGGGCTCTGGGAGG + Exonic
1132666151 16:1082176-1082198 GCACAGATGTGGGCTGTGGGTGG - Intergenic
1132858512 16:2058178-2058200 GGAGAGATGCAGGCTGAGGCAGG - Intronic
1133024498 16:2982070-2982092 GCTGGGATCCTGGCTGGGGGCGG + Intergenic
1135867137 16:26114141-26114163 GCTCAGATGCAGGTGGTGTGGGG + Intronic
1136133845 16:28242092-28242114 GCTTTGAAGAAGGCTGTGGGTGG + Intergenic
1136282215 16:29220587-29220609 GCTGAAGTGCAGGCTTCGGGAGG - Intergenic
1136690387 16:32024374-32024396 GATGTGTTGCAGGCTGTGAGAGG + Intergenic
1136702501 16:32157049-32157071 GTGGAGATCCAGGTTGTGGGAGG - Intergenic
1136717247 16:32290451-32290473 GCTCAGTGCCAGGCTGTGGGGGG - Intergenic
1136765166 16:32770439-32770461 GTGGAGATCCAGGTTGTGGGAGG + Intergenic
1136790976 16:32967938-32967960 GATGTGTTGCAGGCTGTGAGAGG + Intergenic
1136802933 16:33099945-33099967 GTGGAGATCCAGGTTGTGGGAGG - Intergenic
1136835622 16:33496705-33496727 GCTCAGTGCCAGGCTGTGGGGGG - Intergenic
1136878837 16:33885994-33886016 GATGTGTTGCAGGCTGTGAGAGG - Intergenic
1137608226 16:49801181-49801203 ACAGAGAGGCAGGCTGTGGCAGG - Intronic
1138196528 16:55056602-55056624 GCTGGCATGCATGCTCTGGGTGG - Intergenic
1138562229 16:57808318-57808340 GCTGAGAGGCGGGCCGGGGGCGG - Intronic
1140363999 16:74367796-74367818 GCTGAGGTGCAGGCTCCTGGAGG + Intergenic
1141592171 16:85076641-85076663 GCGGAGAGGATGGCTGTGGGAGG - Intronic
1141605382 16:85150182-85150204 GGGTAGCTGCAGGCTGTGGGAGG - Intergenic
1141804756 16:86335434-86335456 GCTGAGTTGGAAGCTGTTGGAGG - Intergenic
1141976098 16:87517590-87517612 GCTGAGATGCCGGCTTTAGATGG + Intergenic
1142033204 16:87848659-87848681 CCTGAGATGCGGGCTGGGAGGGG - Intronic
1142086587 16:88186505-88186527 GCTGAAGTGCAGGCTTCGGGAGG - Intergenic
1142202675 16:88768576-88768598 CCTGACAAGCAGGTTGTGGGCGG + Intronic
1142308513 16:89299136-89299158 GCAGAGAGTCAGGCTGTGGCAGG + Intronic
1142418427 16:89955626-89955648 GCCGAGAGTCAGGGTGTGGGAGG + Intronic
1203009182 16_KI270728v1_random:227327-227349 GCTCAGTGCCAGGCTGTGGGGGG + Intergenic
1203067555 16_KI270728v1_random:1032672-1032694 GTGGAGATCCAGGTTGTGGGAGG + Intergenic
1203093181 16_KI270728v1_random:1229395-1229417 GATGTGTTGCAGGCTGTGAGAGG + Intergenic
1203145801 16_KI270728v1_random:1797020-1797042 GCTCAGTGCCAGGCTGTGGGGGG - Intergenic
1144101241 17:11944106-11944128 GCAAAGATGCAGGGTGTGAGAGG + Intronic
1144555860 17:16282266-16282288 TCTGAGATGCTGGCTATGGTGGG - Intronic
1144775762 17:17783764-17783786 GCTGAGGTGTAGGCGGGGGGCGG + Intronic
1147153243 17:38530509-38530531 GATGTGCTGCAGGCTGTGAGAGG + Exonic
1147657649 17:42099699-42099721 GCTGAGATCCAGGGTTTGAGGGG - Intergenic
1147744379 17:42686246-42686268 CCTGGCATTCAGGCTGTGGGTGG + Intronic
1147889967 17:43710280-43710302 GCTGACAGGCAGGCCCTGGGCGG + Intergenic
1148017710 17:44534064-44534086 GAAGAGGCGCAGGCTGTGGGTGG - Intergenic
1148053392 17:44779970-44779992 GCTGAGCCGCAGGAGGTGGGTGG - Exonic
1148075384 17:44932630-44932652 GCTGAGCTGCAGGGTGGGGGCGG + Intronic
1148082008 17:44972029-44972051 GCTGGGATGCTGTCAGTGGGGGG + Intergenic
1148452737 17:47790413-47790435 GCAAAGATGCAGGTTGAGGGGGG - Intergenic
1148785510 17:50144294-50144316 GCTCAGGTGGAGGCTGTGAGTGG - Intronic
1149094480 17:52824646-52824668 TCTGGGATTCAAGCTGTGGGTGG - Intergenic
1149812441 17:59690356-59690378 GCTAGGATGCAGCCTGAGGGAGG - Intronic
1150072531 17:62163973-62163995 GATAAGAAGCAGGCTGTGGTAGG - Intergenic
1150073253 17:62170554-62170576 CCTGGGATAAAGGCTGTGGGTGG + Intergenic
1150508553 17:65724784-65724806 GCTGAGAGCCAGCCTGTTGGTGG - Intronic
1150634792 17:66905355-66905377 GCACAGATGCAGGCTCTGGCAGG + Intergenic
1151370287 17:73643331-73643353 GCGGGGATGCTGGGTGTGGGTGG + Intronic
1151599126 17:75095365-75095387 GCTGAGATGCCTGCTGGGGGTGG - Intronic
1151815392 17:76469163-76469185 ACGGAGATGAAGGCTGTGGCAGG - Exonic
1151960201 17:77401845-77401867 GCAGAGATGCAGGCTGGAGTGGG - Intronic
1151965821 17:77430698-77430720 GCTAAGAAGCAGGCCGAGGGTGG + Intronic
1151999520 17:77636765-77636787 ACAGAGATGAAGGCTGTGTGAGG - Intergenic
1152238204 17:79149320-79149342 GCCCAGATGCAGGCAGTGGGGGG + Intronic
1152408913 17:80112239-80112261 GCTGGGGTGCAGGCAGCGGGTGG - Intergenic
1152595393 17:81235426-81235448 GGTGACACACAGGCTGTGGGAGG - Intronic
1153075676 18:1159318-1159340 GATTGGATGTAGGCTGTGGGAGG - Intergenic
1154122511 18:11663363-11663385 GCTGGGAGGCTGGCTGAGGGTGG + Intergenic
1156451111 18:37266921-37266943 ACTGAGATGCTGGTGGTGGGGGG + Intronic
1157190893 18:45580769-45580791 GCTGAGATTCAGACTGAGGCTGG + Intronic
1157751507 18:50182821-50182843 GCCTAGAACCAGGCTGTGGGGGG + Intronic
1157933803 18:51852356-51852378 GTTATGATACAGGCTGTGGGAGG - Intergenic
1158990090 18:62859373-62859395 CCTGAGATCCTGGCTGTGGGAGG + Intronic
1159081483 18:63740480-63740502 TCTGAGATTCAGACTGTGGTGGG + Intergenic
1160759837 19:778022-778044 GCAGAGCTGCAGGCCGGGGGCGG + Intergenic
1160762796 19:794073-794095 GGTGAGGTGGAGGCGGTGGGGGG + Intergenic
1160806780 19:995414-995436 GCTGGGATCCAGGCGCTGGGTGG - Intronic
1160963369 19:1734652-1734674 GCTGAGATTCAAGGTGGGGGCGG + Intergenic
1161028923 19:2049089-2049111 GCTGAGTTGGAGGCTGTGGCTGG - Intronic
1161535755 19:4817709-4817731 GCTGCGGTGCAGGCTGAGGAAGG + Exonic
1161793424 19:6373789-6373811 GCTGAAACTCTGGCTGTGGGAGG + Intronic
1161804008 19:6431892-6431914 GCTGAGATTGAGGTTGTGGATGG - Intronic
1163668529 19:18614094-18614116 GCTTCCACGCAGGCTGTGGGAGG - Exonic
1165301236 19:34970682-34970704 GCTGAGATGCCTGATGTGTGTGG + Intergenic
1165395867 19:35563322-35563344 GCTGGGAACCAGGCAGTGGGCGG - Intronic
1166646391 19:44534925-44534947 GCTGTCATTCAGGCTGTGGTTGG + Intergenic
1167030400 19:46955448-46955470 GCTGAAAGGCTGGCTGTGTGGGG - Intronic
1167103947 19:47419653-47419675 GGGGAGGGGCAGGCTGTGGGGGG + Intergenic
1167315978 19:48762882-48762904 GATGAGCTGCAGGGTGTGGGCGG + Intergenic
1167768986 19:51502009-51502031 ACTGAGAGGGAGGCAGTGGGCGG - Intergenic
1168215374 19:54921289-54921311 GTAGTAATGCAGGCTGTGGGTGG - Intergenic
1168236589 19:55067501-55067523 GCTGGCATGCAGGGTATGGGAGG + Intronic
1168355326 19:55696545-55696567 GCTGGGGTGAAGGCTGTGTGGGG + Intronic
1168684543 19:58340236-58340258 GCTGAGATGCAGGCTGCTCTGGG + Exonic
1202643469 1_KI270706v1_random:119558-119580 GGAGAGATGCAGGCTTTGGCTGG - Intergenic
926158231 2:10469791-10469813 GCTGAGCTGCAGGCAGTATGTGG + Intergenic
926305947 2:11637317-11637339 GCTGGGATGCTGACTGTGGGTGG + Intronic
926712648 2:15894290-15894312 GCTGAGGTGCAGACTGGGGAGGG - Intergenic
927108287 2:19846071-19846093 GCTGATTTGCAGCCTGTGAGTGG - Intergenic
927111855 2:19869307-19869329 GCTGGGCGGCAGGCTGTGGGGGG - Intergenic
927177875 2:20422885-20422907 GCTGAGATGCCTGCTGTGGGGGG - Intergenic
927949721 2:27159318-27159340 GCTGGGATGTAGGAGGTGGGTGG - Intergenic
927954877 2:27201204-27201226 GCTGGGATGTAGGAGGTGGGTGG - Intronic
929033462 2:37670611-37670633 ACTGAGAGCCAGGCTGTGGCTGG - Intronic
929516884 2:42611554-42611576 ATTGAGATGCAGTCTTTGGGAGG + Intronic
931618806 2:64189488-64189510 GCAGAGATGAAGGCTGTGGGTGG - Intergenic
931832449 2:66066687-66066709 CCTGGGATCCAGGCTGTGGGAGG + Intergenic
932012602 2:67993365-67993387 GCTTAGATACAGGCTGTCCGTGG - Intergenic
932914655 2:75843613-75843635 GCTGAGGTGCAGCCTCTAGGAGG - Intergenic
933902446 2:86859734-86859756 GCAGAGATGCAGGAGTTGGGAGG + Intronic
934505851 2:94893017-94893039 GGAGAGATGCAGGCTTTGGCTGG - Intergenic
934614942 2:95764912-95764934 GCTGAAACCCAGGTTGTGGGAGG + Intergenic
934645961 2:96059575-96059597 GCTGAAACCCAGGTTGTGGGAGG - Intergenic
934839364 2:97615665-97615687 GCTGAAACCCAGGTTGTGGGAGG - Intergenic
935307011 2:101746988-101747010 GCTCAGATGCAGGTTGAGGTTGG + Intronic
935617339 2:105100293-105100315 GCTGAGCTGCCAGGTGTGGGAGG + Intergenic
936462815 2:112724692-112724714 GGGGAGAGGCAGGCTGTGGTGGG + Intronic
937095203 2:119230827-119230849 GCTGGCGTGCAGGCTGCGGGAGG + Exonic
937237550 2:120439944-120439966 GCTATGATGCAGGTTGTGGAGGG - Intergenic
937251621 2:120527602-120527624 TCTGATGTGCAGGCTGGGGGTGG + Intergenic
938108914 2:128551449-128551471 GATGAGCTGAAGGCTGTGGCTGG + Intergenic
938288980 2:130139678-130139700 GCTCAGAAGCAGGCTGGGGGCGG + Exonic
940000569 2:148963039-148963061 GCTGACATGCAGTGGGTGGGTGG + Intronic
940172338 2:150842894-150842916 GGTGAGAGACAGGCAGTGGGCGG + Intergenic
942017018 2:171827984-171828006 GCTTAGATGCTGTCTGTGGAGGG - Intronic
943214419 2:185012639-185012661 ACTGAGATTCAGGCTGCAGGTGG + Intergenic
944323462 2:198376205-198376227 GATGAGATACAGGCTGGGTGTGG - Intronic
946134870 2:217637338-217637360 GCTGAGCTGGTGTCTGTGGGAGG - Intronic
946382040 2:219355330-219355352 GCAAAGAGGCAGGCTGTGGAGGG + Intergenic
947373974 2:229476347-229476369 GCTGAGAGGCAGGGGGAGGGCGG - Intronic
947454261 2:230238925-230238947 GTTGAATTGCAGACTGTGGGAGG + Intronic
947669111 2:231925663-231925685 GCCGAGCCGCAGGCTGCGGGCGG - Exonic
948704263 2:239779343-239779365 GCTGACATGGATGCTGTGTGTGG - Intronic
948948647 2:241234984-241235006 GGTGAGATGCAGGCAGTGCCAGG - Intronic
949021127 2:241742057-241742079 GGGGAGATGCAGGCAGAGGGTGG + Intronic
949048794 2:241885877-241885899 GCAGGGCTGCAGGCTGTGGACGG + Intergenic
1169072527 20:2742043-2742065 TCTGAGAGGCAGGCTGTGTGGGG - Intronic
1169247896 20:4038252-4038274 GCAGAGAGGCAGGGTGAGGGTGG + Intergenic
1170543465 20:17411912-17411934 CCTCAGCTGCAGGCTGTTGGAGG - Intronic
1170737548 20:19024918-19024940 GCAGAGGTGAAGGCTGTGGGAGG + Intergenic
1171276153 20:23858039-23858061 GCAGAGATGGAGGTTATGGGCGG - Intergenic
1171445239 20:25198014-25198036 GCTGTGAGGCAGGCTTTGTGGGG + Intronic
1171893438 20:30738497-30738519 GGAGAGATGCAGGCTTTGGCTGG - Intergenic
1172474321 20:35226297-35226319 CCTGAGAGGCAGCCTGGGGGAGG - Intergenic
1172484036 20:35287853-35287875 GCTGAGTCGCAGCCTGTGGAGGG - Exonic
1172672788 20:36645871-36645893 GCTGAGACGCATGCTCTGGCTGG + Exonic
1172789804 20:37495092-37495114 GATGAGGAGCAAGCTGTGGGTGG - Intronic
1173005346 20:39135758-39135780 GCTGTGATGGAAGCTGTGGTTGG + Intergenic
1173410826 20:42808184-42808206 GATGAGCAGCAGGCTGCGGGAGG - Intronic
1174044751 20:47725719-47725741 GCAGAGAGGCAGGCTGGGTGGGG - Intronic
1176074499 20:63242285-63242307 GCAGAGATGGAGACTGTGGGAGG - Intronic
1176089817 20:63313791-63313813 GCTGACCTGCAGGCTGTCGGGGG - Exonic
1176608411 21:8853071-8853093 GGAGAGATGCAGGCTTTGGCTGG + Intergenic
1178943532 21:36927205-36927227 GCTGAGATGCAGGCTGTGGGCGG - Intronic
1179742601 21:43426719-43426741 GCGGAGATACCGGGTGTGGGGGG - Intronic
1181656016 22:24299517-24299539 GCTGAGATGCAGACTGTTCAAGG - Intronic
1184555426 22:45230138-45230160 GCTGAGGTCCAGGCTGTGCCTGG - Intronic
1184654723 22:45935349-45935371 GCTGGGCTGCAGGCAGTGGTGGG - Intronic
1185226054 22:49653477-49653499 TCTGAGATCCATGCTGTGTGTGG + Intronic
1185343499 22:50301690-50301712 GGTGAGAAGGGGGCTGTGGGCGG - Intronic
949556736 3:5160043-5160065 GTTCACATGCAGGCTGTGTGGGG - Intronic
950212805 3:11136386-11136408 ACTGAGGTGCAGGCTGTGTGTGG - Intergenic
951082662 3:18469980-18470002 TCCCAGATGCAGGCTCTGGGTGG - Intergenic
951636976 3:24790065-24790087 GCAGACATCCAGGCTGAGGGAGG - Intergenic
952268634 3:31811139-31811161 GCTCAGATGTAGCCTGTGGATGG + Intronic
952890472 3:38037024-38037046 GCTGAGATGAGGACTGAGGGGGG + Intergenic
953494159 3:43372195-43372217 TCTGAGATGCTGGCTGGTGGTGG - Intronic
953714481 3:45306139-45306161 GCAGAGATGAAGGCTGAGTGGGG - Intergenic
953737134 3:45505223-45505245 GCTGAGATTGAGGCTGAGGCGGG + Intronic
954680626 3:52344142-52344164 GGGGAGGTGCAGGCTGTGAGTGG + Intronic
954778780 3:53045032-53045054 GCTGAAAAGGAGGCTGTGGAGGG - Intronic
955612771 3:60775426-60775448 CCTGGGATTCAAGCTGTGGGCGG + Intronic
955985031 3:64564145-64564167 GGTGGGATGATGGCTGTGGGGGG - Intronic
957196758 3:77078776-77078798 GGTGAGTTGCGGGGTGTGGGAGG - Intronic
958130822 3:89419804-89419826 GCAGGGATGCAGGGGGTGGGAGG - Intronic
960014564 3:112871886-112871908 GCACAGATGCAGGCTGTAGTGGG + Intergenic
961203476 3:125062554-125062576 GCAGAGATGGAGGCTGAGGCAGG - Intergenic
961557785 3:127708407-127708429 GCTCGGATGGGGGCTGTGGGTGG + Intronic
961641003 3:128364820-128364842 GCTGCCATGCAGGCTGTGGAGGG - Intronic
961684347 3:128618995-128619017 GGTGAGAAGGAGGCTGTGGGAGG - Intergenic
961804028 3:129476007-129476029 GCCAAGATGGAGACTGTGGGTGG - Intronic
961826278 3:129600797-129600819 GCTGAGATGCCAGGTGGGGGCGG - Intronic
962315089 3:134354227-134354249 GTGGAGCTGCAGGCTGTGGCAGG - Intergenic
962627603 3:137241968-137241990 GCTGAGTTCCAGGATGAGGGGGG - Intergenic
962753057 3:138448852-138448874 GTTGAGATTCAGGCTAAGGGAGG + Intronic
966111584 3:176408831-176408853 GCTGAGATGCTGGCTATGGGGGG + Intergenic
966863348 3:184242611-184242633 GCAGAGCTGCAGGATGTGGAAGG + Exonic
966986624 3:185186235-185186257 TCTGAGATGCAGCCTGTTGAGGG + Intergenic
967809716 3:193746555-193746577 CCTGAGATACAGGCTGAGAGTGG - Intergenic
967914291 3:194566837-194566859 GCAGGGATGGAGGCTGTGTGTGG - Intergenic
968517020 4:1019680-1019702 AATGAGATGGCGGCTGTGGGGGG - Intronic
968525011 4:1052315-1052337 GCTGTGCTGCAGGCAGTGGGGGG - Intergenic
968805361 4:2768421-2768443 GCTGAGATGAAGGCTCCGTGGGG - Intergenic
968939533 4:3630844-3630866 GCTTTGCTGCAGGCTGTGGGCGG + Intergenic
969351226 4:6599060-6599082 GACCAGGTGCAGGCTGTGGGTGG - Intronic
969379937 4:6788306-6788328 GAAGAGATGCAGGCTGGGCGTGG - Intronic
969959174 4:10925864-10925886 TCTGAGCTGGAGGCTTTGGGAGG + Intergenic
971385785 4:26139502-26139524 ACTGAGCTGCAGGCTGTGACTGG - Intergenic
972765530 4:42150557-42150579 ACTGACATGCAGGATTTGGGGGG + Intronic
973239548 4:47942650-47942672 GGTGAGCTGCAGGGTGAGGGAGG + Intronic
976147338 4:82054979-82055001 GCTGAGATGCAAGCTGGGCTAGG - Intergenic
978292055 4:107153071-107153093 TCTGATTTGCAGGCTGCGGGTGG + Intronic
978362147 4:107942285-107942307 GCTGAGGTGCAGACAGTGGGTGG - Intronic
978541084 4:109816701-109816723 GCTGAAATACAGGCTGGGTGCGG + Intronic
981339196 4:143600839-143600861 GCAGAGATGTTGGCTGTGCGTGG - Intronic
981386844 4:144141762-144141784 GCGGAGATGCAGACTTGGGGAGG + Intergenic
982115275 4:152093831-152093853 GCTGAGAAGCAGGTTGGGAGAGG + Intergenic
982122389 4:152155797-152155819 GGTGAGAGCCATGCTGTGGGAGG - Intergenic
982844636 4:160234434-160234456 GCTGTTCTGCAGGCTGTGGTGGG - Intergenic
983826321 4:172266243-172266265 GCTGAGAGGAAGGCTGTTGGGGG + Intronic
1202770839 4_GL000008v2_random:205472-205494 GGAGAGATGCAGGCTTTGGCTGG - Intergenic
985943166 5:3155229-3155251 GCTGGGAAGGAGACTGTGGGAGG + Intergenic
986418352 5:7550784-7550806 GCTGAGATGCTGAGTGTGAGTGG - Intronic
986716863 5:10531140-10531162 CCTGAGGATCAGGCTGTGGGGGG - Intergenic
989193760 5:38695823-38695845 GCTTCCAAGCAGGCTGTGGGCGG + Intergenic
990136067 5:52645372-52645394 CCTGAGGTGCAAGCTGTTGGTGG - Intergenic
991089760 5:62682813-62682835 GCTGAGATGGAGGTTGCAGGAGG + Intergenic
991976704 5:72190228-72190250 GAAGAGATGCAGGCTTTGAGGGG + Intronic
992001888 5:72444062-72444084 GCAGAGCTGCTGGCTCTGGGGGG + Exonic
992543107 5:77783834-77783856 GCAGGGGTGCAGGCTGTGGTAGG + Intronic
993495207 5:88601195-88601217 GCTGAGATGGGGGCACTGGGAGG - Intergenic
994459015 5:100050258-100050280 GCTGATAATTAGGCTGTGGGTGG + Intergenic
997262160 5:132473722-132473744 GCTGAGGTGCTGGCTCTGAGTGG - Intronic
997443055 5:133922108-133922130 GCTCAGGTGCAGGCAGTGTGAGG + Intergenic
997528736 5:134569565-134569587 GCTGACAAGCAGGCTGTGCAGGG + Intronic
997855940 5:137372829-137372851 GATGAGATGCAGGCGGAGAGTGG - Intronic
997890512 5:137672285-137672307 TGTGGGAGGCAGGCTGTGGGAGG - Intronic
998053239 5:139053736-139053758 GAGGAGATGGAGGCTGAGGGTGG - Intronic
998137340 5:139681094-139681116 CCTGACATGGAGGCTGTGGCAGG + Exonic
999300547 5:150487454-150487476 GCTGAGACACAGGCTGAGAGAGG - Intronic
999342749 5:150786970-150786992 GCTGAGTTGTAGTCTCTGGGAGG + Intronic
1000022257 5:157328227-157328249 GCTGGACTGCAGGCTGTGTGAGG - Intronic
1000201315 5:159013591-159013613 CCTGAGATCCAGGCTGAGGCTGG + Intronic
1001437577 5:171712203-171712225 AATGAGAGGCAGGCTGAGGGTGG - Intergenic
1002175851 5:177400652-177400674 GCTGTGAGGCAGGCTGGGCGGGG + Intergenic
1002189060 5:177469462-177469484 GCGGAGATTGAGGCTGAGGGCGG - Intronic
1002327416 5:178418911-178418933 GCTGTGGGGCAGGCTGGGGGTGG - Intronic
1002559427 5:180071630-180071652 GCTGACCTGCAGCCTGTGGCCGG - Exonic
1003233130 6:4272618-4272640 GCTGAGATGGCGGGGGTGGGGGG - Intergenic
1003853616 6:10250403-10250425 GCAGAGATGGAGGCTGTTTGGGG - Intergenic
1004325742 6:14672602-14672624 GAGGAGATGGAGGCTTTGGGAGG + Intergenic
1004545612 6:16595663-16595685 GCTGAAAGGCAGGCAGTGAGGGG + Intronic
1005302770 6:24486993-24487015 TGGGAGATTCAGGCTGTGGGTGG - Intronic
1006075484 6:31529665-31529687 GCTTTGTTGCAGGCTGTGGCTGG - Intronic
1006410634 6:33871337-33871359 GGTGAGAAGCAGGCGGGGGGTGG - Intergenic
1006458020 6:34143093-34143115 GCTAAGGTGCGGGGTGTGGGGGG + Intronic
1006460046 6:34152901-34152923 GCAGAGACCCAGGCTGGGGGTGG + Intronic
1006834012 6:36985996-36986018 GCTGAGCCGCAGGCCGAGGGTGG + Exonic
1007724550 6:43907178-43907200 GCTCTGAGGGAGGCTGTGGGAGG - Intergenic
1010453740 6:76030969-76030991 CCTGGGATTCAAGCTGTGGGTGG + Intronic
1012531087 6:100237275-100237297 GCTCCAATGCAGGCGGTGGGAGG - Intergenic
1012926435 6:105272870-105272892 ACTGAGAAGCAGGCAGGGGGAGG - Intergenic
1015704317 6:136071376-136071398 GCTGAGGTGAAGGCTGAGGTTGG - Intronic
1018733856 6:166672989-166673011 CCTGACCTGCAGGCTCTGGGTGG + Intronic
1018827661 6:167421768-167421790 GGGGAGCCGCAGGCTGTGGGGGG - Intergenic
1019110148 6:169702701-169702723 GCTGGGGTGCAGGCTGCTGGCGG - Exonic
1019117441 6:169776599-169776621 GCTGAGACACAGGCAGTGGGTGG + Exonic
1019436825 7:1026566-1026588 GTTGAGAAGCAGGCTTTGTGTGG - Intronic
1019497440 7:1347039-1347061 GCTGAGAGGCAGGCTGAGGTCGG - Intergenic
1019624301 7:2008301-2008323 TCTGTGATGGAGGCAGTGGGTGG + Intronic
1019721709 7:2576240-2576262 GGTTAGATGCAGGCTGAGGCTGG + Intronic
1020016508 7:4834873-4834895 GCAGAGCTGCCGGCTGTGCGGGG - Exonic
1021387586 7:20050798-20050820 GCTGAGAGGCAGACTGTAGAAGG - Intergenic
1021944860 7:25716660-25716682 TGGGAGATGCAGGCTGTGTGTGG - Intergenic
1022067009 7:26869018-26869040 GCAGAGATGGAGGGTGTGGCAGG - Intronic
1023198420 7:37667097-37667119 GCCAACGTGCAGGCTGTGGGAGG + Intergenic
1023411544 7:39893458-39893480 GCTGGGATGAAGGCTGAGGCAGG - Intergenic
1024346404 7:48319039-48319061 GCAGAGGCACAGGCTGTGGGGGG + Intronic
1024483338 7:49888567-49888589 GCTGGGATGCAGGCTGCCTGAGG - Intronic
1025829662 7:65038311-65038333 GCTGAGGTGGAGGCGGAGGGAGG + Intergenic
1025916920 7:65873327-65873349 GCTGAGGTGGAGGCGGAGGGAGG + Intronic
1026539927 7:71270813-71270835 GCTGAACTTCAGACTGTGGGAGG - Intronic
1026661688 7:72308348-72308370 AGTGAGATGCTGTCTGTGGGGGG + Intronic
1027050741 7:75019785-75019807 CCTGAGATGCAGGCAGGGGCCGG + Intronic
1027268359 7:76506053-76506075 GCTCTGATGCAGGAAGTGGGGGG - Intergenic
1027435519 7:78160113-78160135 ACTGGTCTGCAGGCTGTGGGAGG + Exonic
1027721146 7:81743298-81743320 GCTTAGATCCAGTCTGTGAGAGG + Intronic
1028563488 7:92201875-92201897 TCTGTGCTGCAGGCTGTGTGAGG - Intronic
1028796437 7:94908213-94908235 GCTGAGTTGCAGGCTGGGGGTGG + Intronic
1029176622 7:98669322-98669344 GCTGGGATACAGGCTGCAGGTGG + Intergenic
1029193849 7:98790611-98790633 GATGAGATGCAAGCTGGGCGCGG + Intergenic
1030153293 7:106427060-106427082 GCTGACCTGCAGCCTGTGCGAGG - Intergenic
1032467333 7:132154174-132154196 GCTGAGAAGGAGGCTGTAGGGGG + Intronic
1033243373 7:139699481-139699503 GCTGGGTTGGAGGCTGTGGATGG - Intronic
1034349422 7:150406422-150406444 GCTGGGATGGTGGCAGTGGGGGG + Intronic
1034646204 7:152650012-152650034 GCACAGAGGCAGGCTGTGCGTGG - Intronic
1035114991 7:156516988-156517010 GCTGTCATGGAGGCTGTGTGAGG + Intergenic
1035115054 7:156517290-156517312 GCTGTGAGGGAGGCTGTGTGAGG + Intergenic
1035115080 7:156517422-156517444 GCTGTGAAGGAGGCTGTGTGAGG + Intergenic
1035115102 7:156517528-156517550 GCTGTGAAGGAGGCTGTGTGAGG + Intergenic
1035244348 7:157552503-157552525 GCCGAGGTGCAGGATGAGGGAGG + Intronic
1035589628 8:802620-802642 GGTGAGATGCAGCCTCTCGGGGG - Intergenic
1036075478 8:5494489-5494511 GTTGAGATGTGGGCTCTGGGGGG + Intergenic
1037179901 8:15992719-15992741 GCTGTGATGGTGGCAGTGGGTGG + Intergenic
1037605430 8:20433999-20434021 GGTGAGATGCAGGGTGGAGGTGG - Intergenic
1038039686 8:23714399-23714421 GCTAAGAGGCCGGCTGGGGGAGG - Intergenic
1038503251 8:28062969-28062991 GGGGAGATGCAGGTTGGGGGTGG - Intronic
1038584686 8:28778122-28778144 GCTGGGATGGACCCTGTGGGTGG + Intronic
1039306262 8:36266675-36266697 GCTGATATGGAGGCTGTAGAAGG - Intergenic
1039970866 8:42320667-42320689 GCTGAGATGCAAGATCTGCGGGG - Intronic
1040355560 8:46614774-46614796 GGAGAGATGCAGGCTTTGGCTGG - Intergenic
1040627070 8:49161168-49161190 GCAGAGGTGCAGGCTGTGCTGGG - Intergenic
1041090818 8:54299577-54299599 GCAGAGAGGAAGGCTCTGGGAGG + Intergenic
1042154764 8:65832594-65832616 GCTAAGCTGGAGGCTGTGGTGGG - Intronic
1042566687 8:70118474-70118496 GCAGAGGTGCTGGCTGTTGGTGG - Intronic
1044714501 8:95088200-95088222 GGTGAGAGGCAGCCTGTGGGAGG - Intronic
1045361878 8:101440548-101440570 GCCAGGATGTAGGCTGTGGGTGG - Intergenic
1046504776 8:115123374-115123396 TCTAAGATGAAGGCTGGGGGAGG + Intergenic
1048147945 8:131863859-131863881 GGTGAGTTGCAGGCTTTGGTTGG + Intergenic
1048216699 8:132502137-132502159 TGTGAGCTCCAGGCTGTGGGAGG - Intergenic
1048641652 8:136369974-136369996 GGTGACATCCAGGTTGTGGGGGG + Intergenic
1048853745 8:138669130-138669152 GCTCAGATCCAGGCTTTAGGAGG + Intronic
1048923832 8:139253249-139253271 GCCGAGATGGAAGCTGGGGGAGG + Intergenic
1048997398 8:139802393-139802415 TCTGAGATCCTGGCTATGGGAGG + Intronic
1049031866 8:140043973-140043995 GCTTACCTGCAGGCTGTGGCTGG - Intronic
1049052026 8:140205766-140205788 GCTGAGATGGAGACTGTAGGAGG - Intronic
1049476785 8:142800578-142800600 TCTGAGCTGCAGGCTGAGCGGGG - Intergenic
1049602507 8:143514405-143514427 GCTGGGAGGCAGGCCCTGGGTGG - Intronic
1049664370 8:143836494-143836516 GCTGACACCCAGGCTCTGGGAGG - Intronic
1049687901 8:143946318-143946340 GCAGAGCTGGGGGCTGTGGGAGG - Intronic
1049753100 8:144294934-144294956 GTTGAGAAGCTGGCTGAGGGAGG - Intronic
1050387648 9:5108005-5108027 GCTGATAAGTAGGCTGTGGATGG - Intronic
1051170018 9:14312984-14313006 ACTGCGCTGCAGGCGGTGGGCGG - Intronic
1052357159 9:27516971-27516993 GCTGAGAGATAGCCTGTGGGAGG - Intronic
1052736172 9:32344796-32344818 GTGGAGAGGCAGCCTGTGGGAGG - Intergenic
1053014667 9:34654960-34654982 ACTGAGATGGAGGGTGTGAGGGG + Intronic
1053423632 9:37997031-37997053 GCTGACAGGCAGGAGGTGGGTGG + Intronic
1053455102 9:38227454-38227476 GCTAGGATGCAGGCTGGGGGTGG + Intergenic
1054355200 9:64054215-64054237 GGAGAGATGCAGGCTTTGGCTGG + Intergenic
1054451235 9:65404488-65404510 GCTTTGCTGCAGGCTGTGGGTGG - Intergenic
1056286405 9:85091763-85091785 GATGAAATTCAGGCTGTGGTGGG + Intergenic
1056395428 9:86176868-86176890 GCTATGAGGGAGGCTGTGGGAGG + Intergenic
1056701799 9:88917446-88917468 GGTGAGAAGGAGGCTGAGGGTGG + Intergenic
1058476755 9:105342509-105342531 GCTGAGATGAAAGCTGAAGGAGG - Intronic
1058993567 9:110277731-110277753 GCTGCGATCCAAGCTGTGAGAGG + Intergenic
1059531047 9:115036032-115036054 TTTAAGATGCAGGCTGTGGGTGG + Intronic
1059978187 9:119740512-119740534 GCTGAGATGAAGTCTGTGGCTGG + Intergenic
1060070246 9:120540858-120540880 GCTGAGCAGCATGCTGTGAGAGG + Intronic
1060549868 9:124479838-124479860 GCTGAGATGTAGGTGGTCGGGGG - Intergenic
1060796448 9:126515492-126515514 GCTGAGATGCCGGCTGGTGGGGG - Intergenic
1061023953 9:128035294-128035316 CCTGAGTTTCAGGCTCTGGGTGG - Intergenic
1061053993 9:128212156-128212178 CCTGAGATCCTGGCTGTGGAAGG - Intronic
1061193361 9:129094760-129094782 GCTGAGAGGCAGGCAGGGTGGGG - Intergenic
1061442836 9:130618318-130618340 GCTGAGATACAGGCTCTGCTTGG + Intronic
1061826481 9:133261258-133261280 GCCGGGGTGCTGGCTGTGGGCGG - Intronic
1061859906 9:133462667-133462689 GCCAGGCTGCAGGCTGTGGGTGG + Intronic
1062528700 9:136990075-136990097 TCTGAGATGCTGGCTGTAGCAGG - Intergenic
1203743527 Un_GL000218v1:23320-23342 GGAGAGATGCAGGCTTTGGCTGG + Intergenic
1203703810 Un_KI270742v1:18281-18303 GGAGAGATGCAGGCTTTGGCTGG + Intergenic
1186066879 X:5776040-5776062 GCTGAGATGGAGGCTGGTGTAGG + Intergenic
1187739735 X:22342414-22342436 GGTGAGGAGCAGCCTGTGGGAGG + Intergenic
1189301990 X:39958725-39958747 GGGCAGAGGCAGGCTGTGGGTGG - Intergenic
1190105313 X:47556449-47556471 GCTGAGAGGACGGCGGTGGGAGG + Intergenic
1190931994 X:54956713-54956735 CCTGAGATGAGGACTGTGGGAGG - Intronic
1192832695 X:74767265-74767287 GCTGAGATGCAGTATGCTGGGGG + Intronic
1196700645 X:118664181-118664203 GCTGATTTGCTGGCTGTGGGAGG + Intronic
1200281495 X:154780925-154780947 GGTGGGATGCAGGCTCTGGCAGG - Intronic