ID: 1178945715

View in Genome Browser
Species Human (GRCh38)
Location 21:36946060-36946082
Sequence GAACCATAAGAGCACCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 70}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178945715 Original CRISPR GAACCATAAGAGCACCCTTG TGG (reversed) Intronic
902148448 1:14422830-14422852 GAACCATAAGGAAAGCCTTGGGG - Intergenic
903299013 1:22364811-22364833 GAATAATCAGAGCAACCTTGAGG - Intergenic
908878294 1:68702323-68702345 GAACCATAAGAGCACTTATGGGG + Intergenic
911512800 1:98827945-98827967 AAACCATGAGAGCAGCCGTGAGG + Intergenic
918107956 1:181429360-181429382 GCAACAGAGGAGCACCCTTGGGG - Intronic
1063095506 10:2905214-2905236 CAACCATAGCATCACCCTTGGGG + Intergenic
1068369160 10:56091444-56091466 AACCCATAAGAGCAGCCATGTGG + Intergenic
1072319807 10:94238023-94238045 GAATTATAAGAGCACCCTGTAGG - Intronic
1075320482 10:121487739-121487761 GAACCATAAGAAAATCCTAGCGG + Intronic
1075752646 10:124786094-124786116 GTACCATAGGAGCTTCCTTGTGG - Intronic
1076803065 10:132841443-132841465 CACCCATAAGAGCAGCCATGTGG - Intronic
1081745318 11:45468735-45468757 GAACCATAACACCTACCTTGTGG - Intergenic
1087702491 11:101451252-101451274 GAACCATAAGAGCCACCAGGAGG + Intergenic
1097531575 12:60808102-60808124 GAACCAAAAAAGCACCCAAGTGG - Intergenic
1102852950 12:116268036-116268058 GGTCAATAAGAGCTCCCTTGAGG + Intronic
1107480362 13:40781025-40781047 GAACCAGCAGAGCACGTTTGGGG - Intergenic
1109380448 13:61552225-61552247 CAATCATCAGAGCACCCCTGGGG - Intergenic
1109597932 13:64580841-64580863 TAATGATAAGGGCACCCTTGAGG - Intergenic
1112659828 13:101495402-101495424 GGAACAGAAAAGCACCCTTGTGG - Intronic
1112798823 13:103088062-103088084 GAAACATAAGAACATCCTTGTGG + Intergenic
1114335362 14:21683837-21683859 GAACCTTCAGATCACCCTTATGG + Intergenic
1115601442 14:34959436-34959458 GGACCTTAAGAGCACCTCTGTGG - Intergenic
1116827072 14:49683036-49683058 GAACTATAAAAGGGCCCTTGGGG + Intronic
1118839447 14:69500035-69500057 GGACAACAAGAGCACCCTTGGGG - Intronic
1122790248 14:104181372-104181394 GAACCACAAGAGCCCCCTCCCGG + Intergenic
1124214842 15:27797801-27797823 GAAACACAGGAGCACCCTGGGGG + Intronic
1124515349 15:30362826-30362848 GAACGTTAAGAGCAGCCCTGAGG + Intronic
1124727573 15:32167903-32167925 GAACGTTAAGAGCAGCCCTGAGG - Intronic
1124806713 15:32891216-32891238 GAACCATAAAAGAACCCACGTGG - Intronic
1131160439 15:90101903-90101925 GAACGAGACGAGCACCCGTGGGG - Intronic
1135939222 16:26806480-26806502 GAAGCATCAGAGCAGCCTTTGGG - Intergenic
1135982026 16:27155200-27155222 GAACGCTGAGAGCCCCCTTGTGG - Intergenic
1146772151 17:35578710-35578732 GAAACAGAAGAGGGCCCTTGTGG + Intronic
1151533763 17:74725403-74725425 CCACCATAAGAGCAACCTTGGGG + Intronic
1159135028 18:64327371-64327393 GAACCATATGAACAGTCTTGTGG - Intergenic
1163056750 19:14725800-14725822 AACCCATAAGAGCAGCCATGGGG - Intronic
1164912240 19:32022357-32022379 GAACCACAAAAGCACCCACGTGG + Intergenic
1166069297 19:40377947-40377969 GGAGCATAAGGGCACCCTCGGGG - Intronic
1166509143 19:43392550-43392572 GAACCAAAAGAGCACCCAAGAGG + Intergenic
931027137 2:58123331-58123353 GAAGCATAAGAGCACTGGTGAGG + Intronic
931073047 2:58675971-58675993 AAACCACAAGAGCAGCCATGTGG - Intergenic
931937068 2:67210632-67210654 GGACCACAAGAGCACCATTTGGG - Intergenic
932144294 2:69305225-69305247 GGGCCATAGGAGCATCCTTGGGG - Intergenic
932819202 2:74885242-74885264 TAACCCTCACAGCACCCTTGTGG - Intronic
937280126 2:120711983-120712005 GAATCAGAGGAGCACGCTTGGGG + Intergenic
1170624592 20:18021574-18021596 GAATCCTCAGAGCACCCCTGGGG - Intronic
1173314737 20:41932959-41932981 GACCCATGAGAGCAGCCTTGGGG + Intergenic
1174193683 20:48757995-48758017 GTACCATGACAGGACCCTTGGGG + Intronic
1178812942 21:35900168-35900190 GAACCATTTGAGCTCACTTGGGG - Intronic
1178945715 21:36946060-36946082 GAACCATAAGAGCACCCTTGTGG - Intronic
950899118 3:16480839-16480861 GATTCATAAAAGCAGCCTTGAGG - Intronic
957559942 3:81810694-81810716 GAACCAAAAGAGAACCCATGTGG - Intergenic
959553088 3:107686331-107686353 TAACCATAAGAGAAACCTTCTGG + Intronic
959862311 3:111229952-111229974 AACCCATGAGAGCAGCCTTGGGG + Intronic
969477098 4:7427925-7427947 GAACCATATCACCACCCCTGAGG + Intronic
993946557 5:94122723-94122745 AAACCATGAGAGCAGCCCTGGGG - Intergenic
997532589 5:134591425-134591447 GCACCATCAGAACACCATTGTGG + Intergenic
999906684 5:156148906-156148928 GAACGATAAAAGCACTCTTGCGG - Intronic
1001663935 5:173416870-173416892 CAGCCACAAGAGCACCCTTTGGG - Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1009599574 6:65781320-65781342 CAACCAAAAGGGCACCCTTTGGG + Intergenic
1016113134 6:140250959-140250981 CAACATGAAGAGCACCCTTGAGG - Intergenic
1017076342 6:150622440-150622462 GCACCAAAAGAGTACCCATGGGG - Intronic
1018626942 6:165789002-165789024 CAGCCAGAAGAGCAGCCTTGTGG - Intronic
1020689170 7:11333270-11333292 GTACCTAAAAAGCACCCTTGAGG - Intergenic
1025702641 7:63834115-63834137 GAACCATAGTCACACCCTTGTGG + Intergenic
1027536250 7:79405584-79405606 GAAACATACTAGCACTCTTGGGG - Intronic
1029923349 7:104289677-104289699 GATCCATGAGAGGACCCCTGAGG - Intergenic
1034410700 7:150940586-150940608 GGACCATAAGAGGACACATGTGG - Intergenic
1039188362 8:34943348-34943370 GAGACATAAGACCACTCTTGGGG + Intergenic
1043794195 8:84514871-84514893 GAACTATAAGAGCTCTCTAGAGG - Intronic
1043807098 8:84685210-84685232 GAAACAGAAGAGCAGCCGTGAGG + Intronic
1048750047 8:137662701-137662723 GAACCGTAAGAGAACGCTAGAGG + Intergenic
1049193658 8:141303645-141303667 GAACCCCAAGAGAAACCTTGGGG + Intronic
1049266222 8:141669243-141669265 GGAGCAGAAGAGCACACTTGTGG - Intergenic
1055525124 9:77125561-77125583 GAACCAAGAAAGCAACCTTGTGG - Intergenic
1059406654 9:114102614-114102636 AAACCATAAAAGCAGCCTTAGGG + Intergenic
1189378106 X:40481436-40481458 GAACCATGAGACCAGCCTTGGGG + Intergenic
1193724763 X:85025796-85025818 AATCCATAAGAGCAGCCCTGGGG - Intronic
1198624193 X:138550715-138550737 GAACCAGAAGAGCAGGCTGGGGG + Intergenic