ID: 1178948473

View in Genome Browser
Species Human (GRCh38)
Location 21:36966858-36966880
Sequence AGCTCCGGAGGCCGCGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178948469_1178948473 -6 Left 1178948469 21:36966841-36966863 CCGGCTGTGTGATGGGGAGCTCC No data
Right 1178948473 21:36966858-36966880 AGCTCCGGAGGCCGCGCCCAGGG No data
1178948468_1178948473 -5 Left 1178948468 21:36966840-36966862 CCCGGCTGTGTGATGGGGAGCTC No data
Right 1178948473 21:36966858-36966880 AGCTCCGGAGGCCGCGCCCAGGG No data
1178948466_1178948473 0 Left 1178948466 21:36966835-36966857 CCGCGCCCGGCTGTGTGATGGGG No data
Right 1178948473 21:36966858-36966880 AGCTCCGGAGGCCGCGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178948473 Original CRISPR AGCTCCGGAGGCCGCGCCCA GGG Intronic