ID: 1178953793

View in Genome Browser
Species Human (GRCh38)
Location 21:37006294-37006316
Sequence CGGGCCTCGCTTTCCTCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 247}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178953783_1178953793 14 Left 1178953783 21:37006257-37006279 CCGAGGGAGTGCGCCCGACGGAA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1178953793 21:37006294-37006316 CGGGCCTCGCTTTCCTCTCCCGG 0: 1
1: 0
2: 4
3: 23
4: 247
1178953778_1178953793 22 Left 1178953778 21:37006249-37006271 CCCAGTCCCCGAGGGAGTGCGCC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1178953793 21:37006294-37006316 CGGGCCTCGCTTTCCTCTCCCGG 0: 1
1: 0
2: 4
3: 23
4: 247
1178953780_1178953793 16 Left 1178953780 21:37006255-37006277 CCCCGAGGGAGTGCGCCCGACGG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1178953793 21:37006294-37006316 CGGGCCTCGCTTTCCTCTCCCGG 0: 1
1: 0
2: 4
3: 23
4: 247
1178953779_1178953793 21 Left 1178953779 21:37006250-37006272 CCAGTCCCCGAGGGAGTGCGCCC 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1178953793 21:37006294-37006316 CGGGCCTCGCTTTCCTCTCCCGG 0: 1
1: 0
2: 4
3: 23
4: 247
1178953776_1178953793 24 Left 1178953776 21:37006247-37006269 CCCCCAGTCCCCGAGGGAGTGCG 0: 1
1: 0
2: 0
3: 3
4: 81
Right 1178953793 21:37006294-37006316 CGGGCCTCGCTTTCCTCTCCCGG 0: 1
1: 0
2: 4
3: 23
4: 247
1178953785_1178953793 0 Left 1178953785 21:37006271-37006293 CCGACGGAAACGCCCCTAGCCCG 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1178953793 21:37006294-37006316 CGGGCCTCGCTTTCCTCTCCCGG 0: 1
1: 0
2: 4
3: 23
4: 247
1178953782_1178953793 15 Left 1178953782 21:37006256-37006278 CCCGAGGGAGTGCGCCCGACGGA 0: 1
1: 0
2: 1
3: 5
4: 35
Right 1178953793 21:37006294-37006316 CGGGCCTCGCTTTCCTCTCCCGG 0: 1
1: 0
2: 4
3: 23
4: 247
1178953777_1178953793 23 Left 1178953777 21:37006248-37006270 CCCCAGTCCCCGAGGGAGTGCGC 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1178953793 21:37006294-37006316 CGGGCCTCGCTTTCCTCTCCCGG 0: 1
1: 0
2: 4
3: 23
4: 247
1178953784_1178953793 1 Left 1178953784 21:37006270-37006292 CCCGACGGAAACGCCCCTAGCCC 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1178953793 21:37006294-37006316 CGGGCCTCGCTTTCCTCTCCCGG 0: 1
1: 0
2: 4
3: 23
4: 247
1178953775_1178953793 25 Left 1178953775 21:37006246-37006268 CCCCCCAGTCCCCGAGGGAGTGC 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1178953793 21:37006294-37006316 CGGGCCTCGCTTTCCTCTCCCGG 0: 1
1: 0
2: 4
3: 23
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178953793 Original CRISPR CGGGCCTCGCTTTCCTCTCC CGG Intronic
900173615 1:1282254-1282276 CCAGCATGGCTTTCCTCTCCAGG + Exonic
900420167 1:2552810-2552832 GGTGCCTCGGTTTCCTCACCTGG + Intergenic
900424264 1:2568848-2568870 GGTGCCTCGGTTTCCTCACCTGG - Intergenic
900481353 1:2900970-2900992 CTGCTCTGGCTTTCCTCTCCTGG + Intergenic
900548347 1:3241253-3241275 CGGGCGCCGGTTTCCTCTTCCGG + Intronic
900802722 1:4747346-4747368 CCGGCCTCTGTTGCCTCTCCTGG + Intronic
900808100 1:4781154-4781176 CCAGCCTCGCTGTCCACTCCTGG + Intronic
900932964 1:5748170-5748192 AGGGCCCCCCTTTCCCCTCCAGG + Intergenic
900986812 1:6078026-6078048 CGGGCCGGGCTTCCTTCTCCCGG + Intronic
901137596 1:7007944-7007966 CGGGCCTCCCTTTCCACGCAGGG - Intronic
901866104 1:12107897-12107919 CGGACCTCGATTTCCACACCTGG - Intronic
902811999 1:18893242-18893264 CGAGCCTCAGTTTCCTCACCTGG + Intronic
902856757 1:19211907-19211929 CTGTCCTCCCTTCCCTCTCCAGG + Intergenic
903134836 1:21302715-21302737 TGGGCCTCAGTTTCCTCCCCTGG + Intronic
903419680 1:23209691-23209713 TGAGCCTCACTTTCCTCCCCTGG - Intergenic
903764939 1:25728064-25728086 GGGGCCTGGCTTCCATCTCCTGG - Intronic
904128642 1:28259929-28259951 CGGCCGCCGCTTACCTCTCCGGG - Exonic
904467928 1:30719011-30719033 CGGGCCTCAGCCTCCTCTCCTGG - Intronic
905813458 1:40930019-40930041 GGGGCCTCGCTATCTTGTCCAGG - Intergenic
908403774 1:63794366-63794388 TGGGCCTCGGGTTCCTCACCTGG - Intronic
908789406 1:67766841-67766863 TGGGCCTCGCTTCCCCCTCACGG + Intronic
909246645 1:73293944-73293966 TGTGCCTCGCTTTTCTCTCTGGG - Intergenic
910138352 1:83998931-83998953 CGGGCTGGGCTTTCCTCACCCGG - Exonic
910217572 1:84857824-84857846 CGGGCCTCAGTTTCCTCATCTGG + Intronic
911229056 1:95340723-95340745 GGGGCCTCACTTTGCTCTCAGGG - Intergenic
915345233 1:155193758-155193780 CGGGCCCTGCTTCCCTCTCGCGG - Intergenic
915458002 1:156053480-156053502 CGGCCCCCGCCCTCCTCTCCGGG + Intronic
915838003 1:159193380-159193402 GGGGCCTCTCCTTCCTATCCTGG + Intronic
918177941 1:182061522-182061544 CAGGCCTTGCTCTCCACTCCTGG + Intronic
918423530 1:184386907-184386929 CGCGCCTGGCTCTCCTCCCCGGG - Intergenic
919518516 1:198557156-198557178 CCAGCCTCCCTTCCCTCTCCCGG - Intergenic
919776511 1:201197617-201197639 TGGGCTTCGTTTTCCTCTCTGGG + Intronic
920113735 1:203604906-203604928 TGAGCCTCGGTTTCCTCACCAGG + Intergenic
920295769 1:204955190-204955212 TGGGCCTCAGTTTCCTCTTCTGG + Intronic
921207188 1:212858669-212858691 CGGGCCTGGGTCTCCTCTTCTGG - Exonic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1062932552 10:1362797-1362819 CCGGCCTCGCTGTCTCCTCCCGG + Intronic
1067535169 10:47104208-47104230 TAGGCCTCAGTTTCCTCTCCTGG + Intergenic
1071847587 10:89535872-89535894 CGCGCTACGCTTCCCTCTCCCGG - Intronic
1073336438 10:102714061-102714083 CAAGCCCCGCCTTCCTCTCCAGG + Intronic
1075120394 10:119660225-119660247 CTGGCCTGGCTTTTCTCTCTAGG + Intronic
1075247829 10:120839809-120839831 CGAGCCTCCCTTTCCAGTCCTGG - Intergenic
1075651309 10:124129616-124129638 CTGGCCTTGGTTTCCTCTTCTGG + Intergenic
1076271053 10:129152519-129152541 CGGGCAGCTCTGTCCTCTCCAGG - Intergenic
1076589086 10:131570865-131570887 CTGGCCTGGCTTCCCTCTTCAGG - Intergenic
1076991928 11:279972-279994 CAGGCCTCAGTTTCCTCTACGGG - Intronic
1077434796 11:2533781-2533803 AGGGCCTGGCTTTTGTCTCCAGG + Intronic
1077477260 11:2796409-2796431 CACCCATCGCTTTCCTCTCCCGG + Intronic
1077480558 11:2812558-2812580 CGGGGCTGGCCCTCCTCTCCGGG - Intronic
1079504088 11:21133807-21133829 CGGGCCTCCGTTTGCTCTCAGGG - Intronic
1081585715 11:44382367-44382389 AGAGCCTGGCTTTCCTCTCCAGG - Intergenic
1081747011 11:45480538-45480560 TGGGTCTCGCTCTCCTCTTCTGG + Intergenic
1081858875 11:46320688-46320710 CTGGCCTCTCTTCTCTCTCCAGG + Exonic
1082190566 11:49238082-49238104 CGAGCCCCTCTGTCCTCTCCAGG - Intergenic
1082627489 11:55502434-55502456 CAGGACTGGCTTTCCTCTCCCGG - Intergenic
1084151248 11:67289009-67289031 CCGGCCCCGCCTTCCTCTTCCGG + Intronic
1084934234 11:72578587-72578609 TGGGCCTCAGTTTTCTCTCCTGG - Intronic
1085423009 11:76380405-76380427 GGGGAGTCGCTTTCCTCTCTGGG - Intronic
1085744318 11:79101627-79101649 TGCGCCTCACTTTCCTCTCAGGG + Intronic
1086547543 11:88015627-88015649 CGTAACTCACTTTCCTCTCCTGG - Intergenic
1089062659 11:115638566-115638588 GAAGCCTCTCTTTCCTCTCCAGG - Intergenic
1089560288 11:119340192-119340214 CCGCCCTCGCCTTTCTCTCCCGG + Exonic
1089691913 11:120192230-120192252 TGGGCCCTGCTTTCCTCACCCGG - Intergenic
1091211349 11:133864108-133864130 CGGGCCTCAGTTTCCCCACCAGG + Intergenic
1091230495 11:133984915-133984937 CGGGCCTCTCTGTCCTCTTTGGG - Intergenic
1091913060 12:4247308-4247330 CGGGCCTCACTTTCCTCTGTTGG + Intergenic
1094696168 12:32820976-32820998 CGGGCTTGGTTTTCCTCTGCTGG - Intronic
1094809652 12:34124796-34124818 CGGCACTGGCTTTCCTCTCCCGG + Intergenic
1096006379 12:48176082-48176104 CGAGCCTGCATTTCCTCTCCAGG - Intronic
1098072402 12:66689942-66689964 AGGGCCTCGCTTTCTTGCCCAGG + Intronic
1099960748 12:89394768-89394790 AGGGCCTCACTGTCCTCTCTGGG + Intergenic
1099978806 12:89574745-89574767 AGGGCCTGGCTCTCCTCTCAGGG + Intergenic
1100585512 12:95976014-95976036 CGGGCCTTGGTTTTCTCTCCAGG + Intronic
1100690621 12:97035121-97035143 CTGGCCTGTCTTCCCTCTCCAGG - Intergenic
1100804047 12:98262421-98262443 CAGACCTTGCTTTCCTCTCTGGG - Intergenic
1102046661 12:109833600-109833622 AGGGCCTCAGTTTCCTCGCCTGG + Intergenic
1102429850 12:112874781-112874803 TGGGCCTCAGTTTCCTCACCTGG - Intronic
1103698964 12:122838069-122838091 CCAGCCTCGCTTTCCTCCCCTGG + Intronic
1108206487 13:48095169-48095191 CAGGCCTCTTTTTCCTCTCCTGG - Intergenic
1113699148 13:112370885-112370907 TGGGCCTGTCTTTCCTCTGCTGG - Intergenic
1114483144 14:23047722-23047744 CGGGCCTGGGTTTCCTGCCCTGG - Exonic
1115109635 14:29806077-29806099 CTTGCCTTGCTTTCCTCTCCTGG - Intronic
1117910769 14:60636947-60636969 TGAGCCTCGATTTCCTCTTCGGG - Intergenic
1118791141 14:69094200-69094222 AGGCCCTAGCTTTCCTCTCAAGG - Intronic
1119039754 14:71262636-71262658 CAGGCCTCCCGTTCCTCTGCTGG + Intergenic
1121432703 14:93898946-93898968 CGGGCCTCGCTTCTCTGCCCAGG + Intergenic
1122244163 14:100389805-100389827 CAGGCCTGCCTTTCCTCGCCAGG + Intronic
1122271022 14:100568519-100568541 TGGGCCTGGCTTGCCCCTCCCGG + Intronic
1122719028 14:103711979-103712001 CGGCCCGCCCTTTCCTCTGCTGG - Exonic
1122795984 14:104206467-104206489 CGGGCCTCGCTTTCATCTGGAGG - Intergenic
1127555698 15:60085145-60085167 TGGGCCTTGGTTTCCTCACCAGG - Intergenic
1128506529 15:68277222-68277244 CGGGACTCGCTTTCCTTCCCAGG + Intergenic
1128714874 15:69900842-69900864 TGGGCCTGGCTGTCCTCTCCTGG - Intergenic
1129562051 15:76580561-76580583 GGGGTCTTGCTTTCCTGTCCAGG - Intronic
1130889495 15:88121411-88121433 TGGGCCTCGGTTTCTTCACCTGG + Intronic
1131390928 15:92048316-92048338 CGTCCCTCTCTCTCCTCTCCTGG + Intronic
1131668051 15:94591004-94591026 CTGGCCTGGCTTTCTTCTCTTGG - Intergenic
1132343632 15:101093486-101093508 GGGGTCTCTCCTTCCTCTCCTGG + Intergenic
1132376877 15:101334015-101334037 AGGGCCTTGCTTACCTCTTCCGG - Intronic
1132570859 16:643271-643293 TGTGCCTCGGTTTCCTCCCCTGG - Intronic
1132938579 16:2495452-2495474 AGGGTCTCGCTATGCTCTCCAGG - Intronic
1133034642 16:3028050-3028072 AGGGGCTCACTTTCCTCTTCAGG - Exonic
1135390171 16:22086009-22086031 GAGGCCTCGATTTCCTCACCTGG - Intronic
1135649365 16:24192572-24192594 TGGACCTCCCTTTCCTCTCTTGG + Intronic
1135971266 16:27073719-27073741 AGGGCCTCTCTATCCTCCCCTGG + Intergenic
1136036982 16:27548034-27548056 AGGGCCTCGATTTTCTCTTCAGG + Intronic
1137560371 16:49498448-49498470 AGGCCCCCGCCTTCCTCTCCAGG - Intronic
1137587468 16:49672367-49672389 TGTGCCTCACTTTCCTCTCTGGG - Intronic
1139388413 16:66589257-66589279 GGGGCCTGGCTTTCCTCTCATGG - Intergenic
1140482324 16:75268173-75268195 AGGGCCTCGCTTAGCTCTCAAGG - Intergenic
1141493387 16:84390088-84390110 CGTGCCTCAGTTTCCTCCCCTGG - Intronic
1142049386 16:87948088-87948110 CAGGCCTCGCTTCCCACTCTGGG - Intergenic
1143104950 17:4524919-4524941 CGGGCCGAGGTTTCCTCTCTGGG + Intronic
1143519229 17:7436210-7436232 GGACCCTCGCTTTCCTCCCCAGG + Exonic
1143625545 17:8108637-8108659 TGGGCCTCGGTTTCCTGGCCAGG - Intronic
1143955405 17:10664310-10664332 CGTGCCTTGGTTTCCTCTTCTGG - Intergenic
1144195169 17:12887251-12887273 AGGGCCTTGCTCTGCTCTCCAGG + Intronic
1145863586 17:28226732-28226754 TGGGACTCCCTTTCCTTTCCAGG + Intergenic
1145972030 17:28961781-28961803 CAGGCAGTGCTTTCCTCTCCTGG + Intronic
1146017542 17:29245895-29245917 GGGGGGTCTCTTTCCTCTCCTGG + Intergenic
1147620168 17:41861202-41861224 CTTGCCAGGCTTTCCTCTCCTGG + Intronic
1148038812 17:44689833-44689855 CGGGCCTGGGCTTCCTCTTCAGG - Intronic
1149461735 17:56834369-56834391 CAGGCCTCGCACTCCCCTCCGGG - Intronic
1151823018 17:76507230-76507252 CGGGCCTCACTCTCCTCCCAGGG - Intergenic
1151924648 17:77186159-77186181 AGGCCCTGGCCTTCCTCTCCAGG - Intronic
1152362928 17:79840679-79840701 CGGGCCGCGCTGTCCGCTCCCGG - Intergenic
1152942741 17:83181519-83181541 TGGGCCTGGCTTTCCACGCCTGG + Intergenic
1152942756 17:83181557-83181579 TGGGCCTGGCTTTCCACGCCTGG + Intergenic
1152942772 17:83181595-83181617 TGGGCCTGGCTTTCCACGCCTGG + Intergenic
1152942788 17:83181633-83181655 TGGGCCTGGCTTTCCACGCCTGG + Intergenic
1152942804 17:83181671-83181693 TGGGCCTGGCTTTCCACGCCTGG + Intergenic
1152942820 17:83181709-83181731 TGGGCCTGGCTTTCCACGCCTGG + Intergenic
1152942836 17:83181747-83181769 TGGGCCTGGCTTTCCACGCCTGG + Intergenic
1152942852 17:83181785-83181807 TGGGCCTGGCTTTCCACGCCTGG + Intergenic
1152942868 17:83181823-83181845 TGGGCCTGGCTTTCCACGCCTGG + Intergenic
1152942884 17:83181861-83181883 TGGGCCTGGCTTTCCACGCCTGG + Intergenic
1152942900 17:83181899-83181921 TGGGCCTGGCTTTCCACGCCTGG + Intergenic
1152942916 17:83181937-83181959 TGGGCCTGGCTTTCCACGCCTGG + Intergenic
1152942933 17:83181976-83181998 TGGGCCTGGCTTTCCACACCCGG + Intergenic
1153171224 18:2318208-2318230 TGGGTCTCAATTTCCTCTCCTGG - Intergenic
1157672963 18:49545986-49546008 GGGGCCTCGCTTTATTGTCCAGG + Intergenic
1157724353 18:49952350-49952372 CGGCCCTGGGTTTCCTCTGCAGG + Intronic
1160719021 19:589643-589665 CGGGCCTCAGTTTCCCCTCCTGG + Intergenic
1160754011 19:748354-748376 CTGGCCACGCCTTCCTCGCCAGG - Intergenic
1160878987 19:1311070-1311092 TGCGCCTCGGTTTCCCCTCCCGG - Intergenic
1161062275 19:2221282-2221304 CGGGCTTCGGTGGCCTCTCCAGG - Intronic
1161276715 19:3422419-3422441 CCGGCCTCACTTTCCTTTCAAGG - Intronic
1161397515 19:4052464-4052486 CAGGCCGCACCTTCCTCTCCTGG + Intronic
1161565110 19:4997576-4997598 TGTGCCTCAGTTTCCTCTCCTGG + Intronic
1161614745 19:5263839-5263861 CGGGCCTCCCTTCCCCCGCCCGG - Intronic
1162133255 19:8540203-8540225 AGGGCCTCGCTTTGTCCTCCAGG + Intronic
1162372283 19:10286898-10286920 GGGGCCTCCCCTTCCTCTCCAGG + Intergenic
1163282921 19:16328083-16328105 CGGGCCTCCGTTTCCTCATCTGG - Intergenic
1163686338 19:18713998-18714020 CGGCCCACGCTCACCTCTCCTGG + Intronic
1163726854 19:18928024-18928046 CGGCCCTCACCTTCCCCTCCAGG - Exonic
1163828077 19:19534959-19534981 CGGGCCTCAGTTTCCTCTCCAGG + Intronic
1163829748 19:19541922-19541944 CGCGCCTGGCTCTGCTCTCCCGG + Intronic
1165488363 19:36109001-36109023 TGGGCCTCGGTTTCTTCACCTGG - Intergenic
1165758758 19:38308778-38308800 CAGGCCTCCCTTACCTATCCTGG + Exonic
1165865425 19:38934117-38934139 TGGGCCTCGGTTTCCTCCCTTGG + Intronic
1167100948 19:47404008-47404030 CGGGTCTCGCTTTGTTCCCCAGG - Intronic
1168245796 19:55112646-55112668 CGGCCCTCCCTTGCCTCACCTGG + Exonic
925770839 2:7281760-7281782 CGGACCTAGCATGCCTCTCCTGG + Intergenic
928167192 2:28980017-28980039 CAGGCCTCTCTTTCCCCACCTGG + Intronic
928385198 2:30861467-30861489 TGGGCCTCCCTTTACTCACCTGG + Intergenic
929714017 2:44292698-44292720 CGATCCACGCTTTCCTCTGCTGG - Intronic
930096289 2:47569575-47569597 CAGGCCTCAGTTTCCTCTCCAGG - Intronic
932910309 2:75799755-75799777 TGGGCTTTGCATTCCTCTCCAGG - Intergenic
934054284 2:88239064-88239086 TGGGCCTCGGTTTCTTCACCTGG + Intergenic
934486993 2:94725057-94725079 CGGGCCTCAGTTTCCTCACGGGG + Intergenic
934488446 2:94738843-94738865 CGGGTCTCAGTTTCCTCACCGGG - Intergenic
935729812 2:106056040-106056062 CGGGCCGGTCTCTCCTCTCCAGG + Intergenic
935975154 2:108570822-108570844 TTGGCCTCCCTTTCCCCTCCAGG - Intronic
939956878 2:148534585-148534607 AGAGCGTCGCTTTCCTCTCTGGG + Intergenic
945119681 2:206444125-206444147 CGCCCTTCGCTTTCCTCTGCAGG - Intronic
948061415 2:235045453-235045475 TGGGCCTCCCTGTCCGCTCCAGG + Intronic
949007729 2:241659345-241659367 GTGGCCTCGCTCTCCTATCCCGG + Intronic
949049952 2:241892331-241892353 CTGGCGTCCCTCTCCTCTCCTGG + Intergenic
1168805027 20:667470-667492 TGGGCCTCTGTTTCCTCACCCGG + Intronic
1169909271 20:10634156-10634178 TGGGCCTCAGTTTCCTCTTCTGG + Intronic
1170296365 20:14831073-14831095 CGAGCCTCACTTTGCTCACCTGG + Intronic
1170918764 20:20655607-20655629 CCAGCCTCGCCTGCCTCTCCAGG - Intronic
1171377396 20:24702836-24702858 CCTGCCTCGCTTTCCTTCCCTGG - Intergenic
1171466996 20:25336791-25336813 CAGGCCCCGCTGTCCTCCCCGGG - Intronic
1171981566 20:31632750-31632772 TGGGCCTTGCTCTCCGCTCCTGG + Intergenic
1172122912 20:32609166-32609188 CGAGCCTCAGTTTACTCTCCTGG - Intergenic
1172252636 20:33490394-33490416 CGGGCCTCAGTTTCCACTCCCGG - Intronic
1173251421 20:41366071-41366093 CGGGCCTCCCTTCTCTCCCCTGG - Intronic
1174369022 20:50073718-50073740 TGGGCCTGGCCTTCCTCTCTTGG - Intergenic
1175547073 20:59785285-59785307 CTGGCCTCTGTTTCCTCTACAGG + Intronic
1176963835 21:15189890-15189912 TGGGCCTTTCTTTCCTCTCTAGG - Intergenic
1177875499 21:26626385-26626407 CGGGCGTCCCTGTGCTCTCCGGG - Intergenic
1178953793 21:37006294-37006316 CGGGCCTCGCTTTCCTCTCCCGG + Intronic
1179488724 21:41727070-41727092 CGGTCCTCTCCTGCCTCTCCTGG - Intergenic
1179901722 21:44397651-44397673 CGGGCCTCGTTTTCATCACCTGG + Intronic
1180977364 22:19855614-19855636 CTGCCCTCGCTGTCGTCTCCGGG - Intergenic
1182257814 22:29050742-29050764 CGGGCCTCGCGTCCCACCCCAGG - Exonic
1182353279 22:29710717-29710739 CTGGCCTCACCTTCCTTTCCCGG - Intergenic
1182578793 22:31291425-31291447 TGGGCCTCCCTCTCCTCTCGTGG + Intronic
1183100489 22:35580740-35580762 CAGGCCTCAGTTTCCTCACCTGG + Intergenic
1184247695 22:43244109-43244131 CAGACCTCGCCTTTCTCTCCTGG + Intronic
1184430498 22:44439357-44439379 CTAGCCTCGGTTTCCTCACCTGG - Intergenic
1185061930 22:48611662-48611684 CTGGCCTTTCTTGCCTCTCCTGG + Intronic
950013856 3:9742710-9742732 TGGGCCTACTTTTCCTCTCCTGG - Intronic
952339859 3:32436516-32436538 CAAGCCTGGCTTTCATCTCCTGG + Intronic
954698594 3:52440337-52440359 CAGGCCTCGCTTCCCTGGCCTGG + Intronic
954796127 3:53161995-53162017 CGGGCCTCGCCTCCCGCCCCTGG + Intronic
956251108 3:67235186-67235208 TGGGCCTCAGTTTCCTCTTCTGG + Intergenic
956674917 3:71724952-71724974 CGGGCTGCGCTGTCCTCCCCCGG + Intronic
967987201 3:195104267-195104289 AGAGCCTCGTTTTCCTCTCATGG - Intronic
968451513 4:678243-678265 CGTGCCTCACGTTGCTCTCCTGG + Intronic
968681643 4:1925010-1925032 GGGGCCTCCCTTCCCTCCCCTGG + Intronic
969369771 4:6724219-6724241 TGGGCCTCGGTTTCCTCATCTGG + Intergenic
985543682 5:498790-498812 CTGGCCTCGGCTGCCTCTCCTGG + Intronic
988836221 5:35035316-35035338 CGTGTCTTCCTTTCCTCTCCAGG - Exonic
996442942 5:123512439-123512461 CGTGGCTCGCTTTCCTCCTCCGG + Intronic
999279881 5:150358041-150358063 TGGGCCTCACTTTCCTCATCCGG + Intronic
999327070 5:150650118-150650140 CGGCCCTCGCGCTCCTCACCGGG + Exonic
1003982631 6:11403810-11403832 AGAGCCTCTCTTTCCTCTGCCGG - Intergenic
1005388087 6:25305818-25305840 CAGGCCTCACTTTCCCCACCAGG - Intronic
1010534483 6:77011114-77011136 CGGGCATCCCTGTGCTCTCCAGG + Intergenic
1013512863 6:110859729-110859751 CGGGCCTCACTTTCCTCACCGGG - Intronic
1013990851 6:116252815-116252837 TGGGCCTCGAATTCCTCTACGGG + Exonic
1014266772 6:119286962-119286984 AGGGCCTCGATTTCCTGTTCAGG + Intronic
1014952002 6:127566940-127566962 CAGGCCTCAAATTCCTCTCCTGG - Intronic
1017578861 6:155838058-155838080 CGGTCTTCTCTTTCCTCTTCTGG - Intergenic
1017731896 6:157324126-157324148 CGGGCGTCGCTCTCCTTTCGGGG - Intergenic
1018017839 6:159727695-159727717 CGGCCCGCGCCTACCTCTCCAGG - Intronic
1019642149 7:2109242-2109264 CGGGCCTCGGCTTCTTCTTCAGG + Intronic
1020089912 7:5333175-5333197 TGGGCCTCAGTTTCCTCTCCTGG - Intronic
1020110275 7:5443893-5443915 CGGGCCACGCTTGGCGCTCCTGG - Intronic
1022093356 7:27122701-27122723 TGAGCCTCGCTTCCCACTCCCGG - Intronic
1022388886 7:29926632-29926654 AGTGCCTCTCCTTCCTCTCCAGG - Exonic
1024222548 7:47299844-47299866 CTGGCATCGCATTCCTCACCTGG + Intronic
1024222948 7:47302819-47302841 CGGCTCTGGATTTCCTCTCCAGG + Intronic
1026428951 7:70324971-70324993 TGGGCCTCACTTTCCTCTTCAGG - Intronic
1026859211 7:73774213-73774235 TGAGCCTGGCTTTGCTCTCCTGG + Intergenic
1027864594 7:83629766-83629788 CTGGCTTCACTTTCCTTTCCAGG + Intronic
1032387512 7:131534605-131534627 TGGGCCTGGCTTTCCTCCTCAGG + Intronic
1032733732 7:134670739-134670761 CATTCCTCACTTTCCTCTCCTGG - Intronic
1033365613 7:140671022-140671044 CTGGCCTTCCCTTCCTCTCCAGG + Intronic
1034563444 7:151895939-151895961 CGGGCCCAGCTGTGCTCTCCCGG + Intergenic
1035022828 7:155809162-155809184 CTGTCTGCGCTTTCCTCTCCCGG + Intronic
1035398434 7:158549986-158550008 CGCGCCTCGCCGTCCTCCCCTGG + Intronic
1035604329 8:919751-919773 CCCGCCTCTCTTTCCTCTGCAGG + Intergenic
1035683192 8:1503851-1503873 CGTGCCTGGCTTTCCCCTCTTGG + Intronic
1036587955 8:10142333-10142355 TGGGTCTTGGTTTCCTCTCCTGG - Intronic
1037913365 8:22757536-22757558 TGGGCCTCCCTTTCCTCCCTAGG - Intronic
1040776091 8:51044794-51044816 CAGGCCCTGCTATCCTCTCCAGG + Intergenic
1040907208 8:52480908-52480930 GGGGCTTCTCCTTCCTCTCCTGG - Intergenic
1041870469 8:62628219-62628241 GTGGGCCCGCTTTCCTCTCCAGG - Intronic
1043888228 8:85627259-85627281 CTTGCCCTGCTTTCCTCTCCAGG + Intergenic
1044931667 8:97257864-97257886 AGGGCATCTCTTTCCTTTCCGGG + Intergenic
1045115387 8:98974478-98974500 CGGGCCTCCGCTCCCTCTCCGGG + Intergenic
1047248618 8:123165470-123165492 GGGGCTTCGCTTTTCACTCCCGG + Intergenic
1049317058 8:141975053-141975075 GGGGCCTCTCCTTCCTCTCCAGG + Intergenic
1049398805 8:142415646-142415668 TGGGCCTCACTTTCTTGTCCAGG + Intergenic
1049475133 8:142793804-142793826 TGGGCCTCTCTTCCCTCCCCTGG - Intergenic
1053669341 9:40345522-40345544 CGGGTCTCAGTTTCCTCACCGGG + Intergenic
1053919143 9:42971763-42971785 CGGGTCTCAGTTTCCTCACCGGG + Intergenic
1053920602 9:42985644-42985666 CGGGCCTCAGTTTCCTCACGGGG - Intergenic
1054380471 9:64485543-64485565 CGGGTCTCAGTTTCCTCACCGGG + Intergenic
1054515275 9:66030769-66030791 CGGGTCTCAGTTTCCTCACCGGG - Intergenic
1057140349 9:92722944-92722966 CTGGGCTCCCTCTCCTCTCCAGG - Intronic
1059367831 9:113800485-113800507 GGGGCCTCTCTTCCCTTTCCAGG + Intergenic
1059552489 9:115243437-115243459 TGGGCATCTCTTTCCTCTCTGGG + Intronic
1061216239 9:129223644-129223666 CTGGCTTCGCTTTCCTGGCCTGG - Intergenic
1061766310 9:132883760-132883782 AGGGCCTCGCTTTCTTCTGTGGG + Intronic
1062282922 9:135759965-135759987 CTGGCCTCACTGTCCCCTCCTGG - Intronic
1062689637 9:137834581-137834603 CGGGGCTCGCATTGCTTTCCTGG + Intronic
1187362399 X:18640911-18640933 TGGGCCTGGCTTTCCGTTCCTGG - Exonic
1198442160 X:136673666-136673688 CTGCCCTCACTTTCCTCTCCTGG + Intronic
1199736915 X:150693668-150693690 CGGGCCCCGCTTACCTGTCCAGG - Exonic
1201755601 Y:17482791-17482813 CGGGACTGGCTTTCCTCTCCCGG + Intergenic
1201845951 Y:18423194-18423216 CGGGACTGGCTTTCCTCTCCCGG - Intergenic