ID: 1178960271

View in Genome Browser
Species Human (GRCh38)
Location 21:37058697-37058719
Sequence TGCCAAAGGCTCACAGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178960271_1178960279 -7 Left 1178960271 21:37058697-37058719 CCAAGCCCTGTGAGCCTTTGGCA No data
Right 1178960279 21:37058713-37058735 TTTGGCAGTTTGTGAGGGAGGGG No data
1178960271_1178960280 -4 Left 1178960271 21:37058697-37058719 CCAAGCCCTGTGAGCCTTTGGCA No data
Right 1178960280 21:37058716-37058738 GGCAGTTTGTGAGGGAGGGGAGG No data
1178960271_1178960284 6 Left 1178960271 21:37058697-37058719 CCAAGCCCTGTGAGCCTTTGGCA No data
Right 1178960284 21:37058726-37058748 GAGGGAGGGGAGGGAGGAGGTGG 0: 2
1: 44
2: 360
3: 2299
4: 12610
1178960271_1178960282 0 Left 1178960271 21:37058697-37058719 CCAAGCCCTGTGAGCCTTTGGCA No data
Right 1178960282 21:37058720-37058742 GTTTGTGAGGGAGGGGAGGGAGG No data
1178960271_1178960281 -3 Left 1178960271 21:37058697-37058719 CCAAGCCCTGTGAGCCTTTGGCA No data
Right 1178960281 21:37058717-37058739 GCAGTTTGTGAGGGAGGGGAGGG No data
1178960271_1178960278 -8 Left 1178960271 21:37058697-37058719 CCAAGCCCTGTGAGCCTTTGGCA No data
Right 1178960278 21:37058712-37058734 CTTTGGCAGTTTGTGAGGGAGGG No data
1178960271_1178960277 -9 Left 1178960271 21:37058697-37058719 CCAAGCCCTGTGAGCCTTTGGCA No data
Right 1178960277 21:37058711-37058733 CCTTTGGCAGTTTGTGAGGGAGG No data
1178960271_1178960285 26 Left 1178960271 21:37058697-37058719 CCAAGCCCTGTGAGCCTTTGGCA No data
Right 1178960285 21:37058746-37058768 TGGAACCATAAGCCTCGATAAGG No data
1178960271_1178960283 3 Left 1178960271 21:37058697-37058719 CCAAGCCCTGTGAGCCTTTGGCA No data
Right 1178960283 21:37058723-37058745 TGTGAGGGAGGGGAGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178960271 Original CRISPR TGCCAAAGGCTCACAGGGCT TGG (reversed) Intergenic
No off target data available for this crispr