ID: 1178962126

View in Genome Browser
Species Human (GRCh38)
Location 21:37074311-37074333
Sequence CCTGTTCAGGAGACAGAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 221}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178962120_1178962126 -1 Left 1178962120 21:37074289-37074311 CCAGTGTGGCCTCTTCAGCCAGC 0: 1
1: 0
2: 1
3: 17
4: 240
Right 1178962126 21:37074311-37074333 CCTGTTCAGGAGACAGAATAGGG 0: 1
1: 0
2: 1
3: 16
4: 221
1178962121_1178962126 -10 Left 1178962121 21:37074298-37074320 CCTCTTCAGCCAGCCTGTTCAGG 0: 1
1: 0
2: 0
3: 20
4: 262
Right 1178962126 21:37074311-37074333 CCTGTTCAGGAGACAGAATAGGG 0: 1
1: 0
2: 1
3: 16
4: 221
1178962117_1178962126 25 Left 1178962117 21:37074263-37074285 CCAGCTGCTCCGCAGTGTTGACG 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1178962126 21:37074311-37074333 CCTGTTCAGGAGACAGAATAGGG 0: 1
1: 0
2: 1
3: 16
4: 221
1178962118_1178962126 16 Left 1178962118 21:37074272-37074294 CCGCAGTGTTGACGCTGCCAGTG 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1178962126 21:37074311-37074333 CCTGTTCAGGAGACAGAATAGGG 0: 1
1: 0
2: 1
3: 16
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178962126 Original CRISPR CCTGTTCAGGAGACAGAATA GGG Intronic
902042964 1:13505856-13505878 CGTGTTCCGGGGACAGAACAAGG + Intronic
903995188 1:27301041-27301063 CCCCATCAGGAGACAGAGTATGG - Intronic
906655614 1:47546269-47546291 CCTGTGTAGGAAACAGAAAAAGG - Intergenic
907164762 1:52400585-52400607 CTCGTTCAAGAGACAGAAGAAGG - Intronic
911565648 1:99460760-99460782 CCTTCTCAGCAGACAGAACAAGG - Intergenic
914696472 1:150086089-150086111 CCTGTTAATGATACATAATAAGG + Intronic
917465891 1:175275794-175275816 CCTGTTCAGAAGAAACAAAAAGG + Intergenic
918247220 1:182670841-182670863 CCTGGTTAGGAGAAAGATTAAGG - Intronic
920297923 1:204970647-204970669 CCTCGCCAGGAGCCAGAATAAGG - Exonic
923944583 1:238869913-238869935 CATGTTAAGAAGCCAGAATAGGG + Intergenic
924102106 1:240614957-240614979 GCTGTTCTGGAGAGAAAATAAGG + Intergenic
924111955 1:240708845-240708867 CATATCCAGGAGACAAAATAGGG - Intergenic
1063058510 10:2526762-2526784 CCTGGGCAGGAGACAGATGAGGG + Intergenic
1063752280 10:8963906-8963928 CATGTACATGAGATAGAATAAGG + Intergenic
1067151387 10:43737705-43737727 GCAGGTGAGGAGACAGAATACGG - Intergenic
1067192861 10:44086477-44086499 CCAGTGAAGGAGACAGATTAAGG - Intergenic
1067520884 10:47003778-47003800 CCTGTTGAAGATACAGAACAGGG - Intergenic
1068475026 10:57513850-57513872 CCCGTTCAGGACACAGGGTAGGG + Intergenic
1073806164 10:107100756-107100778 ACAGTTCAGGAGAAAGAACAAGG + Intronic
1074275609 10:111999226-111999248 CATGGTCAGGAGGCAGAAGAAGG + Intergenic
1074665311 10:115715562-115715584 CCTGTTCAGGGGATGGAATCGGG + Intronic
1074698649 10:116073909-116073931 CTGGTTCAGAAGACAGAACATGG + Intronic
1075313565 10:121434077-121434099 CCTGTGCAGGAGGAAGAATATGG + Intergenic
1075557462 10:123443996-123444018 GCTGTGCAGGAAACAGAATAGGG - Intergenic
1078288206 11:9979932-9979954 CCTGTTCAGGAGACTGAGGTGGG - Intronic
1079566819 11:21892490-21892512 ACTGTTCAGGAGACTGAAATAGG + Intergenic
1083064660 11:59912504-59912526 ACTGTTCAGGAAACAGAAGGAGG - Intergenic
1084168140 11:67386628-67386650 CCAGCCCAGGTGACAGAATAAGG + Intronic
1088740477 11:112762925-112762947 CGTGCTCAGGAGCCAGAAGATGG + Intergenic
1090230282 11:125097911-125097933 CCTGAGCAGGAGACACAAGAAGG + Intronic
1090599839 11:128358734-128358756 CATGGTCAGGAGGCAGATTAGGG - Intergenic
1091105179 11:132911952-132911974 CCTCTTCAGGACACAGGAAATGG + Intronic
1094486902 12:30932795-30932817 CCTGTTTCGGAGACAAGATAGGG + Intronic
1095983501 12:47985589-47985611 TTTGTTCAGGAGAGAGAAGAGGG + Intronic
1098019911 12:66143728-66143750 CCTGTTTATGGGACATAATAGGG - Intronic
1102277707 12:111596688-111596710 CCTATTCATCAGAAAGAATAAGG + Intronic
1106152151 13:27115313-27115335 CCTGTTCTGGAGAGAGAGAAAGG + Intronic
1106859816 13:33893509-33893531 CCTCTTCAATAGACAGAATAAGG + Intronic
1107977247 13:45702156-45702178 CCACTTCTGGAGAGAGAATAGGG + Intergenic
1108098988 13:46935105-46935127 CCAATTCAGGACACAGAATCAGG - Intergenic
1108295216 13:49010100-49010122 TCTGGTCAGGAGGCAGAAGAAGG + Intronic
1110858355 13:80321251-80321273 CCTGTTCAGGAGACAGTGAATGG - Intergenic
1111269022 13:85855317-85855339 CCTGTTGAGGAGACAGTGCAGGG - Intergenic
1112823759 13:103367429-103367451 CCTGTTTGGGAGACAGAAGTAGG - Intergenic
1113767960 13:112892742-112892764 CCTGTGCAGGGGACAGGAGAGGG - Intergenic
1113790965 13:113027928-113027950 CCTGTGCAGGTGACAGACAAAGG - Intronic
1115643689 14:35352175-35352197 CCTGCTCAGGAAAGAGAAAAGGG + Intergenic
1115694996 14:35887413-35887435 ACTGTGCAGGAGAAAGAAGAAGG + Intronic
1116503151 14:45645606-45645628 GCTGTTCAGGAGAAATCATAAGG - Intergenic
1117495955 14:56304274-56304296 CCTGTTTAGAAGACAAAAGAAGG - Intergenic
1118745553 14:68770529-68770551 CCTTTTCAGGAGAGAGGACAGGG - Intergenic
1119681141 14:76593133-76593155 CCTGGTCAGGGGACAGGTTACGG - Intergenic
1121755100 14:96395594-96395616 GCTGCTCAGGAGGCAGAATGGGG + Intronic
1123465386 15:20511201-20511223 CCTGTTCAGGGGCCACAACAAGG - Intergenic
1123652730 15:22489836-22489858 CCTGTTCAGGGGCCACAACAAGG + Intergenic
1123743153 15:23298700-23298722 CCTGTTCAGGGGCCACAACAAGG + Intergenic
1124276112 15:28327180-28327202 CCTGTTCAGGGGCCACAACAAGG - Intergenic
1124306588 15:28584427-28584449 CCTGTTCAGGGGCCACAACAAGG + Intergenic
1124611927 15:31215221-31215243 CCTGTGCAGGGGACAGCAGAGGG + Intergenic
1125441599 15:39709283-39709305 CCATTGCAGGAGGCAGAATAAGG + Intronic
1126406740 15:48330665-48330687 CCAGTTAAGGAGACCGAAAAGGG + Intergenic
1127532653 15:59859930-59859952 CCTGTACAGCAGAGAGAAGAGGG - Intergenic
1129742746 15:77997783-77997805 TATGTACAGGAGAGAGAATATGG + Exonic
1129842726 15:78753664-78753686 TATGTACAGGAGAGAGAATATGG - Intergenic
1131260495 15:90885020-90885042 GCTGTTCTGGGGACAGAAAAGGG - Exonic
1131343217 15:91622272-91622294 CCTGGTAATGAGACAGAAAATGG - Intergenic
1131545757 15:93314437-93314459 CTTGTTCAGGGGACAGAAGGAGG + Intergenic
1131718166 15:95136340-95136362 CCTGTTCCGGGGAGAAAATATGG + Intergenic
1134634216 16:15779831-15779853 CCTGTTGAGGAAACAGGAAAAGG - Intronic
1138952224 16:61927088-61927110 CTTGTACAGTAGAAAGAATATGG + Intronic
1141072091 16:80966392-80966414 CCTTTTCAGTGGACAGAATTAGG + Intergenic
1142240768 16:88943888-88943910 CCTGTGCGGGAGACAGACCACGG + Intronic
1142985117 17:3690738-3690760 CCACTCCAGGAGATAGAATAGGG + Intronic
1142993267 17:3746096-3746118 CCTGGTCAGGTGTCAGAAGACGG - Intronic
1144153104 17:12470231-12470253 CCTCTGCAGGAGACAGAACGAGG - Intergenic
1146631555 17:34473831-34473853 CCTTTTCAGGAGACAGCATGAGG - Intergenic
1146786782 17:35728168-35728190 AGTGTTCAGGAGATAGAATTGGG - Intronic
1148603857 17:48913734-48913756 CCTGTTCAGGAGAGAAAATAAGG - Intronic
1149109816 17:53015103-53015125 TTTGTTCAGTAAACAGAATAGGG + Intergenic
1151111753 17:71686428-71686450 CATATTCAGTAGTCAGAATATGG - Intergenic
1151265900 17:72954707-72954729 CCTGATCAACAGTCAGAATATGG + Intronic
1154366646 18:13716476-13716498 CCAGTTTAGGAGAGAGAATTAGG - Intronic
1155526641 18:26722343-26722365 CCTGTTCAGCTGAAAGAAGAGGG - Intergenic
1156114343 18:33769050-33769072 CCTTTTCAGTTGAGAGAATAAGG + Intergenic
1156762802 18:40613672-40613694 GCTATTCTGTAGACAGAATAGGG - Intergenic
1156826951 18:41442136-41442158 TCTGGGCAGGAAACAGAATATGG - Intergenic
1157082987 18:44548555-44548577 GCTGTTTAGGAGAAAGAAGATGG - Intergenic
1157159995 18:45305192-45305214 CTTGTTTGGGAGACAGGATAAGG + Intronic
1158324738 18:56301989-56302011 CCAGTTCGGGAGACACAATTTGG + Intergenic
1158330462 18:56356771-56356793 TCAGTTAAGAAGACAGAATAGGG + Intergenic
1159091162 18:63851028-63851050 CCTGTTCAGCACACAGATTAAGG - Intergenic
1159449325 18:68579596-68579618 CCTGTACAGGAAGCATAATATGG - Intergenic
1159794090 18:72821176-72821198 CTGCTTCAGGAGACAGAAAACGG - Intronic
1166296428 19:41892309-41892331 CCTGCTCAAGAGAGAGAATGGGG - Exonic
1167597611 19:50435754-50435776 TCTGTTCAGGGGACAGGATTAGG - Exonic
1168128598 19:54301878-54301900 CATGGTCAGTAGACAGAACAGGG + Intergenic
926076852 2:9949824-9949846 CCAGTGGAGGAGACAGAAGACGG - Intergenic
927193340 2:20531893-20531915 CCTGTTCTGGAGACGGGAGAGGG - Intergenic
927480388 2:23449183-23449205 CCTGCTGAAGAAACAGAATATGG - Intronic
929742390 2:44616146-44616168 ACAGTTCAAGAGACAGAAGATGG - Intronic
930234687 2:48877396-48877418 CCTGTGCAGTAGACAGACTCTGG - Intergenic
930284290 2:49408896-49408918 CTTGTTCAAGTGACAGAATGAGG - Intergenic
931078982 2:58747669-58747691 CATGTTCACTAGACAGATTATGG + Intergenic
932262797 2:70341428-70341450 TGTGTTGGGGAGACAGAATAAGG + Intergenic
932438746 2:71718466-71718488 CCTGTCCTGGTGACAGAGTATGG - Intergenic
933982641 2:87565573-87565595 CCCTGTCAGGAGACAGAACAAGG - Intergenic
936311199 2:111385220-111385242 CCCTGTCAGGAGACAGAACAAGG + Intergenic
937220584 2:120341108-120341130 CCTGTTTAGGAAATAGAATGGGG + Intergenic
938377607 2:130819091-130819113 CCAGCTCAGGAGACATCATAGGG - Intergenic
938396332 2:130951427-130951449 CCTATTCATGAGACACAATATGG - Intronic
939601109 2:144191264-144191286 CCTGTTCAGTACAGAGAATAAGG - Intronic
941728709 2:168891977-168891999 TCTGCTCAGTACACAGAATAGGG + Intronic
942371784 2:175293481-175293503 CCTGTTCTGGAAACAGAGGAAGG - Intergenic
942513727 2:176729516-176729538 ACTTTTCAGAACACAGAATATGG - Intergenic
946114855 2:217452368-217452390 CCAGTGCAGGAGACAGAAAAAGG + Intronic
946680230 2:222206228-222206250 AGTGTTCAGGAGACAGAACTGGG - Intronic
946823150 2:223650231-223650253 CCTGTGCAGGAGGCATAATGGGG - Intergenic
947572338 2:231245968-231245990 GCTGACCAGGAGACAGAATCTGG + Intronic
947909065 2:233789832-233789854 CATCTGCAGGAGACAGAAGAGGG - Exonic
1170683799 20:18550520-18550542 TCTGTAGATGAGACAGAATACGG - Intronic
1173267822 20:41502091-41502113 TCTGTTCAGAAGACACATTAAGG - Intronic
1175673539 20:60927627-60927649 CCTGTTCAGCTGACAGATTAAGG + Intergenic
1178053202 21:28770224-28770246 CCTGTTGAGGAGTCAGGATGTGG - Intergenic
1178426733 21:32484725-32484747 CCTGTCCAGAAGAGAGATTAGGG - Intronic
1178821892 21:35982901-35982923 CCTTTTCTGGAGACAGGCTAGGG + Intronic
1178962126 21:37074311-37074333 CCTGTTCAGGAGACAGAATAGGG + Intronic
1180619696 22:17152818-17152840 CCTGTTCAGTGGAAAGAAGATGG - Intronic
1182068646 22:27447671-27447693 CCTGTCCGGGAGACACACTACGG + Intergenic
1185019087 22:48363130-48363152 CCTGTTCAGGTGACATAAGGAGG - Intergenic
1185364178 22:50428603-50428625 GCTATTCAGGAGACTGAAGAGGG + Intronic
952183717 3:30945707-30945729 CCCCATCAGGAGACAGAACAAGG - Intergenic
952334101 3:32390490-32390512 CCTGTTCAGGAGGCTGAGTCTGG - Intergenic
952667705 3:35927060-35927082 CATGTGCAGGAGACTGAAGATGG - Intergenic
954341890 3:49960937-49960959 CCAGTTCAGGAAACAGAGTGAGG - Intronic
954747642 3:52796050-52796072 CCTCTTTGGGAGACAGAATGAGG + Intronic
955968376 3:64412340-64412362 CATGTACAGGAGAAACAATAAGG + Intronic
956998951 3:74862186-74862208 CATGTTCAGGTTACAGAATAGGG + Intergenic
957122071 3:76106810-76106832 CCTATTCATCAGACAGAAAAGGG - Intronic
959630912 3:108506335-108506357 CAGGTTGAGGAGAGAGAATATGG + Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961483512 3:127199780-127199802 CATGTCCTGGAGACAGAATTGGG - Intergenic
962580248 3:136791505-136791527 ACACTTCTGGAGACAGAATAAGG - Intergenic
963928630 3:150978563-150978585 CATTTTCAGGAGACACAATCTGG - Intergenic
965954358 3:174350618-174350640 CTTGTTCAGAAGTCAGAAGAAGG - Intergenic
967875177 3:194264004-194264026 CCTGCACATGAGCCAGAATAAGG + Intergenic
970448924 4:16148130-16148152 CCTGCTCAGGAGACAGCCTCTGG - Intergenic
971341763 4:25775956-25775978 TCTGGTCTGGAGACAGCATAGGG - Intronic
972463812 4:39332669-39332691 CCTGTTCAGCGGATAGATTAAGG - Intronic
972851994 4:43061729-43061751 TCTTTTCAGTAGACAGAATTAGG + Intergenic
973840164 4:54853063-54853085 CCTCTTCAGGAGTAAGAATGGGG - Intergenic
974435858 4:61856726-61856748 CCTGTTCAGGAGGCTGAAGCAGG - Intronic
977332154 4:95650859-95650881 CCTGATGTGGAGTCAGAATATGG + Intergenic
978417128 4:108488386-108488408 CCTGAGCAGGAGAGAGAATGGGG + Intergenic
978945470 4:114490650-114490672 TATGTCCAGGAGACAGCATATGG + Intergenic
981127306 4:141121392-141121414 CCAGTTTGGGAGGCAGAATAGGG - Intronic
981764080 4:148228026-148228048 CCTTCTCAGTAGACAGAACAAGG + Intronic
982041469 4:151401211-151401233 CCAGATCAGGAAACAGAATCTGG - Intergenic
983088565 4:163476985-163477007 CCTATTTAGAAGACAAAATAGGG + Intergenic
985119185 4:186622778-186622800 CTTGTTCATGAAACAGAAAAAGG - Intronic
987466564 5:18278749-18278771 TCTGTTCAGGTCACAGTATATGG - Intergenic
987945891 5:24608158-24608180 ACTGGTAATGAGACAGAATATGG + Intronic
990318971 5:54611359-54611381 CATGTTCAGGAGACAGGGCATGG - Intergenic
991081023 5:62599327-62599349 TCTGTTCAGGTGCTAGAATAAGG + Intronic
991330962 5:65491355-65491377 CCTGTTCAGGAAACCAAAGATGG + Intergenic
991654562 5:68891306-68891328 CCTGTTAAGGACACAGCAAAAGG - Intergenic
993202368 5:84832025-84832047 CTTTTTCAGAAGACAGAATCGGG - Intergenic
995412906 5:111878671-111878693 ACTGTTCAGAAGACAGCAAATGG + Intronic
996289537 5:121835456-121835478 CCTCTTCTGAAGACAGAATTCGG - Intergenic
999141207 5:149363501-149363523 GCTGTTCAGCAGTCAGAATGGGG + Intronic
999504255 5:152179134-152179156 CCTGTTAAGGGGGCAGAACATGG - Intergenic
999894522 5:156015558-156015580 CCTGTTTACCAGACAGAAAAAGG + Intronic
999998580 5:157116130-157116152 GCTGCTCAGGAGGCTGAATAGGG - Intronic
1002017664 5:176338305-176338327 CCTGTTCAGGATCCAGCCTAGGG - Intronic
1002080074 5:176732530-176732552 CCAGATCAGGGGACAGAATCGGG - Intergenic
1003130290 6:3389709-3389731 CCTGTGCAGGAGAAAGTACAGGG + Intronic
1003588957 6:7420859-7420881 CCCATTTAGGAGACAGAATGTGG - Intergenic
1004198206 6:13524657-13524679 CCTCTACAGGAGCCAGTATATGG - Intergenic
1005077988 6:21927228-21927250 GCTGCTCAGCAGACAAAATAAGG - Intergenic
1005099894 6:22160125-22160147 CCTATGTTGGAGACAGAATATGG - Intergenic
1005162409 6:22879461-22879483 CCTGTTGAGGTGACAGAGAAAGG - Intergenic
1005993129 6:30915667-30915689 TCTGTTCTGGAGACAGTAGAGGG + Intronic
1007002198 6:38324530-38324552 CCTGCTGAGCAGACAGACTATGG + Intronic
1007397281 6:41585121-41585143 CCTGTTCAGGAGATAGAAGTGGG - Intronic
1012322575 6:97868614-97868636 ACTGTTCAGGAGGCTGAATTAGG - Intergenic
1015453142 6:133393567-133393589 CATGTTCAGGTGACAGAAGAGGG + Intronic
1015899683 6:138051941-138051963 CCTTGTCAGAAGGCAGAATAAGG + Intergenic
1016300308 6:142623188-142623210 CCTGCTCATGAGACAAAATGAGG - Intergenic
1017293438 6:152767676-152767698 TCTGTTCCAGAGACAGAAAATGG + Intergenic
1018451338 6:163910974-163910996 CCTTTTCAGGAGACTGAAATGGG - Intergenic
1019133666 6:169895145-169895167 CATGCTCAGAAGACAGAATGAGG + Intergenic
1019771442 7:2886094-2886116 CTTCTTCAGGAGACAGAGAAGGG - Intergenic
1020874802 7:13679008-13679030 CCTTATCAGTAGACTGAATATGG + Intergenic
1022812040 7:33879272-33879294 CTTGTTCATGAGGCAGAATTTGG + Intergenic
1024972761 7:55085898-55085920 CATGCTCAGGAGACAAAACACGG - Intronic
1026310016 7:69175344-69175366 CCAGTTAAAGAGACAGAATAAGG - Intergenic
1027757625 7:82234843-82234865 CCTGTTTTGGAGACAGAAGTAGG - Intronic
1029192035 7:98778688-98778710 GCTGATCAGGAAACAGAAAATGG - Intergenic
1029725615 7:102401925-102401947 CCTGCTCTGGAAACAGAATGGGG + Intronic
1031721950 7:125187569-125187591 CCTCTTCAGGACACTGAAGAGGG - Intergenic
1031896121 7:127349921-127349943 ACAGTGCAGGAGACATAATAGGG - Intronic
1033550468 7:142442395-142442417 GCTGTTCAGGACACAGCATCAGG - Intergenic
1034597963 7:152217245-152217267 CCTGTACAGGAGAAAAAATAGGG - Intronic
1036531963 8:9598963-9598985 TCTGTTTATGAGACAGAAGAAGG - Intronic
1037948165 8:23002342-23002364 TCAGTTCAGGAGAGAGAATTGGG + Intronic
1038365699 8:26931244-26931266 CCTGTTCAGGAGTCAGGAGCAGG - Intergenic
1038674894 8:29614821-29614843 CCTGTACAGGGGACAGAAGTGGG + Intergenic
1039115841 8:34090397-34090419 CCTGTTCAGAAGAAATAAAAGGG + Intergenic
1039758930 8:40553098-40553120 CCAGTCCAAGAGAAAGAATAAGG - Intronic
1041549711 8:59086398-59086420 CATGTCCAGAAGACAGAATCCGG + Intronic
1042166348 8:65949570-65949592 TCTGTTCAGTAGACAGGGTATGG - Intergenic
1042194480 8:66220806-66220828 CCTGTGAAGGAGAGAGAAAAGGG + Intergenic
1042232511 8:66572498-66572520 GCTGCTCAGGAGAAAAAATATGG - Exonic
1043265475 8:78262249-78262271 CCTGTTTAGGAGAGAGGAAAAGG - Intergenic
1044481868 8:92699852-92699874 CACGTTCAGGAGACACAGTAGGG - Intergenic
1046154748 8:110273311-110273333 CCTGTTAAGAAGACATATTAAGG + Intergenic
1048679040 8:136818608-136818630 CTTTTTCAGGAGACATTATATGG - Intergenic
1049085059 8:140472060-140472082 CCAGTTGAGGAGACAGAGAATGG + Intergenic
1052758187 9:32563455-32563477 CCTGTTCAGGAGGCTGAAGCAGG - Intronic
1054785591 9:69207037-69207059 CCTGGGCAGGAGGCAGAGTATGG - Intronic
1055746430 9:79450579-79450601 CCTGTTCAGCTGACAGAGCAAGG + Intergenic
1055901822 9:81248263-81248285 CCTGTTCACGTGAGAGAATGTGG + Intergenic
1056098546 9:83278615-83278637 CCTGTTCTGGAAAGAGAACATGG + Intronic
1056578398 9:87872760-87872782 CCTGCTCAGGAGGCAGCATCAGG - Intergenic
1056672603 9:88643435-88643457 CCTTTTCAGTAGACAGAGCAAGG + Intergenic
1059580120 9:115536341-115536363 GGTGCTCAGGAGACAGAAGAGGG + Intergenic
1060130824 9:121097375-121097397 CCTGTAAAGGAGGCAGTATAGGG - Intronic
1060654182 9:125357465-125357487 GCTGCTCAGGAGGCTGAATAGGG + Intronic
1061637578 9:131923117-131923139 CCTTCTCAGCAGACAGAATTGGG + Intronic
1186886114 X:13915350-13915372 CCAGTACAGGAGAGAGAATAGGG - Intronic
1189103318 X:38212899-38212921 CTTGGTCAGGAGACAGACTTTGG - Intronic
1190998338 X:55634704-55634726 CCTGGTCAGGAGAGAGATCAGGG - Intergenic
1191120832 X:56902710-56902732 CCTGTTGTGGAGAAAGGATAAGG + Intergenic
1192100306 X:68257360-68257382 CCTGTTCAGGATAAAGAGAATGG + Intronic
1192148280 X:68696151-68696173 GCTGTTCAGCAGATAAAATAGGG + Intronic
1193103191 X:77638900-77638922 GTTGTTCTGGAGACTGAATAAGG + Intronic
1196347175 X:114677031-114677053 CATGTTCAAGAAACATAATATGG + Intronic
1197136470 X:123066170-123066192 GCTATTCAGAAGACAGAATTCGG + Intergenic
1197241971 X:124129692-124129714 CCTGGTCAGAGGACTGAATATGG - Intronic
1198367630 X:135958096-135958118 CCTTTTCAGCAGACAGATCAAGG - Intergenic