ID: 1178966185

View in Genome Browser
Species Human (GRCh38)
Location 21:37120696-37120718
Sequence CCGTGTGGCTCTAAAGGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178966185_1178966191 2 Left 1178966185 21:37120696-37120718 CCAGAACCTTTAGAGCCACACGG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1178966191 21:37120721-37120743 CCCCAGAGCAGGATTACTTATGG 0: 1
1: 0
2: 2
3: 3
4: 107
1178966185_1178966188 -9 Left 1178966185 21:37120696-37120718 CCAGAACCTTTAGAGCCACACGG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1178966188 21:37120710-37120732 GCCACACGGTACCCCAGAGCAGG 0: 1
1: 0
2: 0
3: 20
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178966185 Original CRISPR CCGTGTGGCTCTAAAGGTTC TGG (reversed) Intronic
901893838 1:12291807-12291829 CCATGTAGCTCTAAAAGTTCTGG + Intronic
905170622 1:36107724-36107746 CCCTGTGGCTCTGATGGTGCTGG - Intronic
907310855 1:53538254-53538276 CCGTGAGGCTCTCGAGGGTCTGG + Intronic
912830569 1:112949535-112949557 CCGTGTTGCTTCACAGGTTCTGG + Intronic
922983747 1:229850504-229850526 CCATGAGGCTGTAGAGGTTCTGG + Intergenic
1069989412 10:72305664-72305686 CCCTGTGGCTCTTGTGGTTCTGG - Intergenic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1085117642 11:73944370-73944392 CCTTTTAGTTCTAAAGGTTCTGG + Intergenic
1091007270 11:131964909-131964931 CCGAGTGCCTCTGAAGGTTAAGG - Intronic
1104268579 12:127261501-127261523 CCCTGTGCCTCTGCAGGTTCTGG + Intergenic
1104392974 12:128406843-128406865 CTGTGTGGTTCTAGATGTTCTGG - Intronic
1107670584 13:42742838-42742860 CTGTGTGGCTCTGGAGGGTCTGG + Intergenic
1108631620 13:52289219-52289241 CCGGGTGGGTCCAAAGGTGCTGG + Intergenic
1108655075 13:52523376-52523398 CCGGGTGGGTCCAAAGGTGCTGG - Intergenic
1116037633 14:39646754-39646776 CCATGTGGCTGCAAAGGATCAGG + Intergenic
1122852377 14:104543598-104543620 CCGGGTGCCTCTCAGGGTTCTGG + Intronic
1128845746 15:70892729-70892751 CTGTGTGGCTCTATCGATTCGGG + Exonic
1133824292 16:9263163-9263185 GCGTCTGCCTCCAAAGGTTCAGG + Intergenic
1134216029 16:12317495-12317517 CACTGTGGCTCTAAAGGCACAGG - Intronic
1136650263 16:31663109-31663131 CCTTTTAGTTCTAAAGGTTCTGG - Intergenic
1146689009 17:34860215-34860237 CCGTGGGGCTGGAAAGGTTGGGG - Intergenic
1153914787 18:9735558-9735580 TCGTGTGGCCCTGAAGTTTCCGG + Intronic
1155616944 18:27733153-27733175 AGGTGTGGCTCTGAAGGATCAGG + Intergenic
1161251802 19:3284822-3284844 CCTTGCGGCTCTTAAGGATCGGG + Intronic
1163272652 19:16263445-16263467 CAGTGAGGCTCTGAAGGTGCTGG + Intergenic
1163923716 19:20318952-20318974 CCTTTTAGTTCTAAAGGTTCTGG + Intergenic
1168623564 19:57898403-57898425 CCTTTTAGTTCTAAAGGTTCTGG - Intronic
925199029 2:1951289-1951311 CCCTGTGTCCCTAAGGGTTCAGG - Intronic
936661767 2:114550781-114550803 CTGTGTGTCTCTCAAGGTTAGGG + Intronic
937323869 2:120977526-120977548 CAGTGTGGGTCTAGAGGTTGTGG + Intronic
1171957748 20:31472971-31472993 CCTTGTGGCTCTCCTGGTTCTGG - Exonic
1173089735 20:39958877-39958899 CCCTCTGGCTCTAAATGTTCTGG + Intergenic
1178966185 21:37120696-37120718 CCGTGTGGCTCTAAAGGTTCTGG - Intronic
949946861 3:9196376-9196398 CCTTCTGGCTCCAAAGGTTTTGG - Intronic
957697373 3:83657622-83657644 CAGTGTGGACATAAAGGTTCTGG - Intergenic
959540623 3:107533448-107533470 CCCTGTGGCTCCAAATGTACAGG + Intronic
975637429 4:76464157-76464179 CCCTGTGGCTCTGCAGGTTATGG - Intronic
981914466 4:150018521-150018543 CTGTGTGTCTCTGAAGGTTTAGG - Intergenic
983926780 4:173411299-173411321 CCTTGTGGCTACAAAGATTCAGG + Intergenic
990768872 5:59220264-59220286 ACGTGTGCCTCTAAAGTGTCGGG - Intronic
992645254 5:78805768-78805790 CCGGGTGGCTCTGTGGGTTCCGG + Intronic
1003135699 6:3433345-3433367 CTGTGTGGCCCTACAGCTTCTGG - Intronic
1020415969 7:7946100-7946122 CCATGTGGCTCTAACGGGACTGG - Intronic
1022467895 7:30663664-30663686 CTGCGTGGCTCTAAAGGGGCAGG - Intronic
1023772384 7:43569757-43569779 CCGGGTGGCTCTAATGATCCTGG - Intergenic
1037754916 8:21704414-21704436 CTGTGTGGCACTAGAGATTCAGG - Intronic
1043878430 8:85512999-85513021 CCGTGTGACTCTTAATGTTGTGG + Intergenic
1043935782 8:86140726-86140748 CCCTGTTGCCCTAAAGGTTGGGG - Intronic
1048533870 8:135274446-135274468 CCCAGTGGCTCTAATGGCTCCGG + Intergenic
1052030239 9:23620241-23620263 CCTTGTGGATCTGAAGGTTATGG - Intergenic
1055311837 9:74990860-74990882 CTGTAAGGCTCTAAAAGTTCTGG + Intronic
1195526838 X:105901047-105901069 CTGTGTGACTGTAAATGTTCTGG - Intronic