ID: 1178968383

View in Genome Browser
Species Human (GRCh38)
Location 21:37146671-37146693
Sequence AGACCAGTGATTGCTGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178968379_1178968383 25 Left 1178968379 21:37146623-37146645 CCTATGAAATCTCCAGAATAAGC 0: 1
1: 0
2: 8
3: 26
4: 246
Right 1178968383 21:37146671-37146693 AGACCAGTGATTGCTGGGCCTGG 0: 1
1: 0
2: 2
3: 27
4: 270
1178968378_1178968383 30 Left 1178968378 21:37146618-37146640 CCATTCCTATGAAATCTCCAGAA 0: 1
1: 5
2: 104
3: 867
4: 2117
Right 1178968383 21:37146671-37146693 AGACCAGTGATTGCTGGGCCTGG 0: 1
1: 0
2: 2
3: 27
4: 270
1178968380_1178968383 13 Left 1178968380 21:37146635-37146657 CCAGAATAAGCAAGTCTGTATAT 0: 1
1: 0
2: 7
3: 43
4: 368
Right 1178968383 21:37146671-37146693 AGACCAGTGATTGCTGGGCCTGG 0: 1
1: 0
2: 2
3: 27
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178968383 Original CRISPR AGACCAGTGATTGCTGGGCC TGG Intronic
900162680 1:1231875-1231897 AGACCGGTGAGTGAGGGGCCCGG - Exonic
900295948 1:1949672-1949694 AGATCACTGGTTGCTGGGGCAGG - Intronic
901167882 1:7232666-7232688 AGACCGGTGTTTGCAGGGGCCGG + Intronic
901689393 1:10962822-10962844 ATATAAGTGTTTGCTGGGCCAGG + Intronic
903464043 1:23539717-23539739 AGATTAGTGATTGCTGGGAATGG + Intergenic
903831155 1:26175932-26175954 AAAACAGGGAATGCTGGGCCGGG - Intergenic
903838623 1:26222370-26222392 ATAAAAGTGATTGCTGGGCGTGG - Intergenic
903966528 1:27094075-27094097 AGACCAGTGTGTTCTGGGCCGGG - Intergenic
904486145 1:30825535-30825557 AGACCAGTCATTGCAGGGACTGG + Intergenic
905742050 1:40379820-40379842 AGAGCAGTGTCTGCTGGGCATGG - Intronic
905816095 1:40952263-40952285 AGAACAGAGATTGCTGGCCACGG + Intergenic
905854367 1:41298265-41298287 AGATCAGTGGTTGCAGGGCCTGG + Intergenic
906167117 1:43694668-43694690 AAACCAGTGATTGCAGGAACTGG - Intronic
906712381 1:47940606-47940628 AGATCAGTGGCTGCAGGGCCAGG + Intronic
910297230 1:85661259-85661281 AGACCAGTGAATGATGGAGCCGG - Intronic
910888037 1:91987213-91987235 AGAAAAGTGATTGATAGGCCAGG - Intronic
914781674 1:150791293-150791315 ATACAATAGATTGCTGGGCCTGG - Intergenic
919861629 1:201742537-201742559 AGAACAGTGTTTGCTGGGACAGG - Intronic
919932125 1:202227967-202227989 AGACCAGAGAATGCTTGTCCTGG - Exonic
920004097 1:202820210-202820232 AGACCTTTGTTTGCTGTGCCTGG + Intergenic
920299719 1:204981248-204981270 AGAGGACTGATTCCTGGGCCAGG + Intronic
922343442 1:224676320-224676342 AGATTAGTGGTTGCTGGGCAGGG + Intronic
923483265 1:234404638-234404660 TGACCAGCCTTTGCTGGGCCAGG + Intronic
1062808172 10:440791-440813 AAACCCCTGATTGCTGGGCTAGG + Intronic
1062822516 10:545444-545466 ACACCAGTCATGGCTGGGCGTGG - Intronic
1063781397 10:9329424-9329446 AGAACACTGCTTGCTGGGCATGG + Intergenic
1064743495 10:18456662-18456684 AGAATAGTGGTTGCTAGGCCTGG - Intronic
1065959221 10:30720645-30720667 AGATCAGTGGTTGCTGGGGTTGG + Intergenic
1066622126 10:37367180-37367202 AGAGCAGTGATTGGTAGGGCAGG + Intronic
1067114652 10:43425809-43425831 AGACCCGTTATAGCTGGGCGCGG - Intergenic
1067209333 10:44245889-44245911 AGACCAGGGCTTCCTGGGACTGG + Intergenic
1067939110 10:50637688-50637710 AGCCCAGTGATTCCCAGGCCTGG - Intergenic
1069729677 10:70602614-70602636 AGAGCAGGGATTGGGGGGCCTGG - Intronic
1070702032 10:78610974-78610996 ACACCAGGGCTTGCTGGGTCAGG - Intergenic
1072101799 10:92236450-92236472 AATACAGTGATTGCTAGGCCGGG + Intronic
1072567741 10:96631475-96631497 AGAGCAGTCCTGGCTGGGCCTGG + Intronic
1073810980 10:107152014-107152036 AGAGCAGTGGGTTCTGGGCCTGG - Intronic
1074492122 10:113947576-113947598 AGTCCAGGGAACGCTGGGCCAGG - Intergenic
1075671580 10:124266998-124267020 AGACCAATGCTTTCAGGGCCAGG - Intergenic
1076875347 10:133213140-133213162 AGACCACTGCCCGCTGGGCCTGG + Intronic
1079121847 11:17691396-17691418 AGATTAGTGATTTCTGGGGCTGG + Intergenic
1080010315 11:27452534-27452556 AGACCAGTGGTTGCTAGGGTTGG - Intronic
1081132771 11:39401229-39401251 AGATCAGTGGTGGCTGGGCACGG + Intergenic
1081426821 11:42934537-42934559 AGACCATTGGTGGCCGGGCCTGG - Intergenic
1081753471 11:45528473-45528495 AGACCTGTGGTTGCTGAGCTGGG + Intergenic
1085518806 11:77126378-77126400 AGAGCAGGGATTGCTATGCCTGG - Intergenic
1087759477 11:102090350-102090372 GGACAAGTGATTGCTGGGTCCGG + Intergenic
1088750621 11:112839281-112839303 AGCCCAGTGATGGCGAGGCCTGG + Intergenic
1091535111 12:1399561-1399583 AGATCAGTGGTTGCCAGGCCTGG - Intronic
1091948594 12:4572192-4572214 AGACCAGTGGTTTCTTAGCCTGG + Intronic
1092761768 12:11817088-11817110 AGTCCAGTGAGTGCTGGAACCGG - Intronic
1095766153 12:45898251-45898273 AGAACAGTGGTTACTGGGGCTGG + Intronic
1095774192 12:45994237-45994259 AAACCAGTGGTGGCTGGGCATGG + Intergenic
1096309407 12:50506603-50506625 ATACCAGTGATTCCCGGGACTGG - Intronic
1096821453 12:54238721-54238743 AGCCCTTTGATTGCTGGGCTGGG - Exonic
1099738926 12:86605730-86605752 ATACCAGTGCTTGCTGGGAATGG - Intronic
1101039541 12:100740368-100740390 AGGCCAGTGAGAGCTGGGCATGG - Intronic
1102329743 12:112018964-112018986 AGATGAGTGGTTGCTGGGGCTGG + Intronic
1102739081 12:115190145-115190167 AAACCGGTGATTGCAGTGCCTGG - Intergenic
1103380644 12:120491570-120491592 AGACAAGTGATTGCTGGACTGGG + Intronic
1103514778 12:121500424-121500446 AGACAAGGGATGGCTGGGCCTGG + Intronic
1103739698 12:123082884-123082906 AGAACAGTGAGTGCTGGGGCTGG - Intronic
1104056622 12:125235632-125235654 GGATCAGTGATTGCTGGGGCTGG - Intronic
1104360945 12:128132625-128132647 AGACCTGTGGTTCCTGGGGCAGG + Intergenic
1104883557 12:132089425-132089447 AGAACAGTGGTTACTGGGGCCGG - Intronic
1105067649 12:133214882-133214904 AGCCCAGTGCTGCCTGGGCCTGG + Intergenic
1105973281 13:25450819-25450841 AGACCAGTCAGGGCTGGGCGCGG - Intronic
1106873637 13:34048461-34048483 AGATCAGTGGTTGCCAGGCCTGG + Intergenic
1107055332 13:36097197-36097219 AGATCAGTGGCTGCTGGGCTAGG + Intronic
1107716823 13:43208315-43208337 AGGTCAGTGACTGTTGGGCCGGG + Intergenic
1107725486 13:43294943-43294965 AGAGCAGTGGTTGCTGGGAGTGG + Intronic
1110204164 13:72892002-72892024 AGATCAGTGGTTGCCAGGCCTGG + Intronic
1110220780 13:73070644-73070666 AGATCAGTGCTTTCTGGCCCTGG + Intronic
1114182243 14:20376918-20376940 GGAACAGTGATTTGTGGGCCAGG + Intronic
1114619993 14:24089954-24089976 AGAACAGTGATAGCTGAGGCTGG + Intronic
1115219104 14:31041608-31041630 GGACCAGAGATTGTTGTGCCTGG - Intronic
1116908673 14:50433332-50433354 AGACCAGTGCATGCTGGAGCTGG + Intronic
1117301231 14:54430372-54430394 AGACCAGTGATGAGTGGCCCAGG - Exonic
1117519906 14:56541079-56541101 AGATCAGTAAGTGGTGGGCCTGG + Intronic
1120758514 14:88266004-88266026 AGCACAGTGAGTGCTGGGCAAGG - Intronic
1121079166 14:91093928-91093950 AGATCAGTGGTTGCAGGGACTGG + Intronic
1121671394 14:95713519-95713541 AGGCCAGTGTTTGCTATGCCTGG + Intronic
1122924063 14:104891780-104891802 AGGCCAGGGAGTGCTGGGCGGGG + Intronic
1124253298 15:28121726-28121748 AGAACAGGGAGGGCTGGGCCTGG + Intronic
1124695243 15:31858728-31858750 AGCCCAGTGAATGGTGGGGCTGG - Intronic
1125178275 15:36851248-36851270 AGATCAGTGATTGTTGGTCATGG + Intergenic
1126238741 15:46416782-46416804 AGAAAAGAGATTGCTGGGCCTGG - Intergenic
1128266900 15:66274677-66274699 AGAATGGTGGTTGCTGGGCCTGG + Intergenic
1131340268 15:91592737-91592759 AGACCAGTGATTGCCTGTCAGGG - Intergenic
1132415018 15:101613447-101613469 TCACCAGTGACTGCTGGGCCAGG - Intergenic
1132546239 16:534681-534703 AGACCAGAGGCTGCTGGTCCAGG - Intronic
1132588482 16:716220-716242 AGGCCCAGGATTGCTGGGCCCGG - Intronic
1133439287 16:5807035-5807057 GCACCAGTGATGGCTGAGCCTGG + Intergenic
1133537458 16:6715691-6715713 AAACCAGGCATTTCTGGGCCAGG - Intronic
1134018640 16:10906729-10906751 ACACGAGTGATTGCTGTGCTGGG + Exonic
1134030274 16:10986557-10986579 AGAATGGTGATTGCTGGGGCTGG - Intronic
1134091431 16:11393592-11393614 AGACCAGGGACAGGTGGGCCAGG - Intronic
1134383153 16:13747126-13747148 AGATCAGTGACTCCTGGGCAAGG + Intergenic
1134745420 16:16584416-16584438 AGAACAGTCTTTGCTGGGCATGG + Intergenic
1134782784 16:16913790-16913812 AGATTAGTGGTTGCTGGGCGTGG + Intergenic
1135000051 16:18769347-18769369 AGAACAGTCTTTGCTGGGCATGG - Intergenic
1137288234 16:47033833-47033855 AGCCCAGGGCTTCCTGGGCCTGG - Intergenic
1138345640 16:56318415-56318437 AGACCAGGCATTGCAGGGCCGGG - Intronic
1138538812 16:57675785-57675807 AGATTAGTGATTGCAGGGGCTGG + Intronic
1138567237 16:57842301-57842323 AGAAATGTGCTTGCTGGGCCAGG + Intronic
1139549024 16:67663345-67663367 AGAACAGTGAGTGTTGGGCAGGG + Intronic
1139648609 16:68349978-68350000 AGACCAGTGGCTGCCAGGCCTGG - Intronic
1139851682 16:69954281-69954303 AGGCCTTTGACTGCTGGGCCAGG - Intronic
1139880658 16:70177188-70177210 AGGCCTTTGACTGCTGGGCCAGG - Intronic
1140371851 16:74418329-74418351 AGGCCTTTGACTGCTGGGCCAGG + Intronic
1141300776 16:82813628-82813650 AGACCCCAGATTGCTGGGGCTGG + Intronic
1141642856 16:85351490-85351512 AAATGAGTGATTGCAGGGCCTGG + Intergenic
1141691237 16:85597797-85597819 AGACCAGTAATGGCTGAGGCTGG - Intergenic
1141757670 16:86003121-86003143 AGACCCGTGATTGCCGGGGCTGG - Intergenic
1142084642 16:88170452-88170474 AGAGCCGTGGTTGCTGGGGCTGG - Intergenic
1142831884 17:2555236-2555258 AAACAAGTGTTTGCTGGGCCTGG - Intergenic
1143058936 17:4183824-4183846 AGACCAGACTGTGCTGGGCCTGG - Exonic
1144033160 17:11340473-11340495 GGACCAGGCATTCCTGGGCCTGG - Intronic
1144263442 17:13545592-13545614 ACACCAGTGTTTGCTGATCCTGG + Intronic
1145796838 17:27660530-27660552 AGAGCAGTGAGCCCTGGGCCAGG - Intergenic
1147303917 17:39550265-39550287 TGGCCAGTGATTGATGGGCCTGG - Intronic
1148063887 17:44854717-44854739 AGCTCTGTGATTGCTGGTCCTGG + Intronic
1150616749 17:66778221-66778243 AAAACGGTGATGGCTGGGCCCGG + Intronic
1152530236 17:80914401-80914423 AGAGCAGAGATGGCTGGGTCTGG - Intronic
1203165439 17_GL000205v2_random:88981-89003 AGCCCAGTGCATGCTGGGGCTGG + Intergenic
1155984881 18:32219445-32219467 AGATCAGTGAATACTTGGCCTGG + Intronic
1157736565 18:50054870-50054892 AAACTAGTGATGGCTGAGCCAGG + Intronic
1160939006 19:1611488-1611510 AGGCCAGTGAGTGGTAGGCCAGG + Exonic
1161310816 19:3593060-3593082 AGACCTGTGACTGTGGGGCCAGG - Exonic
1161480358 19:4507279-4507301 AAACCTGTGACTGCTGGGCACGG + Intronic
1162452621 19:10764068-10764090 GCATCAGTGATTGCTGGGGCCGG + Intronic
1162601513 19:11673733-11673755 ACACTTGTGATTGCTGGTCCAGG + Intergenic
1163479990 19:17549555-17549577 ATGCCAGTGATTGCTGGGGGTGG + Intronic
1164814636 19:31185838-31185860 AGAACAGTGATTGCTTGGATGGG - Intergenic
1165175585 19:33927397-33927419 AGAAGTGTGATTGCTCGGCCGGG - Intergenic
1165886234 19:39080945-39080967 AAACCACTGATGGCTGGGCACGG + Intergenic
1166966333 19:46531363-46531385 AGACCAGGGTTGGCTGGGCACGG - Intronic
1167713443 19:51125870-51125892 TGTCCTGTGAGTGCTGGGCCGGG + Exonic
1167722025 19:51185712-51185734 CGTCCTGTGAGTGCTGGGCCGGG + Intergenic
1167982628 19:53287734-53287756 AGATTAATAATTGCTGGGCCGGG - Intergenic
1168075986 19:53981334-53981356 AGACCAGTCAGGGCAGGGCCTGG + Intronic
1168666902 19:58211131-58211153 GGACCAGTCATGGCTGTGCCAGG + Intronic
1168696474 19:58406702-58406724 AGAGCACTGATTGATGGACCAGG - Intronic
927035724 2:19174098-19174120 GGACTAGTAAATGCTGGGCCTGG + Intergenic
927460717 2:23296062-23296084 ACACCAGTCATTGCTTGGCACGG - Intergenic
927948615 2:27152559-27152581 AGAGCAGTGATGGCTGGGGAAGG + Intronic
927982519 2:27383124-27383146 AGACCTGTGAGTGCCGGGCGTGG - Intronic
932104009 2:68926559-68926581 AGGCCAATGATTGCAGGGGCAGG + Intergenic
932214090 2:69955124-69955146 GGAGCAGTGACTGATGGGCCTGG + Intergenic
932332210 2:70904179-70904201 AGACCAGTGAGGGCGGGGACGGG + Intronic
932696911 2:73964656-73964678 AGAACAGTGGTTGCTAGGTCAGG + Intergenic
933555556 2:83826253-83826275 AGCCCAGTGATTGCTAGGGGTGG - Intergenic
934039806 2:88118408-88118430 AGTACAGTGATTGGTGGGCAGGG - Intergenic
934956445 2:98624345-98624367 AGATCACTGATTGCTGAGACCGG + Exonic
935219404 2:100999930-100999952 AGGCCAGTGACTACTGGGCCTGG - Intergenic
937181026 2:119996629-119996651 AGATCAGAGGTTGCTGGGGCTGG + Intergenic
937212332 2:120282649-120282671 AGACCAGGGAAAGCTGTGCCTGG + Intronic
937932604 2:127218805-127218827 ATAACAGTGCGTGCTGGGCCGGG + Intronic
939025980 2:137014253-137014275 AGACGTGTGAATGCTGAGCCAGG - Intronic
939468644 2:142591171-142591193 AGGTCATTGATAGCTGGGCCTGG - Intergenic
942057477 2:172198141-172198163 AGACCAGTGCTGCCTGGGGCTGG + Intergenic
943053166 2:182941519-182941541 AGATCAGTGGTTGTTTGGCCTGG + Intronic
946223876 2:218251746-218251768 AGAGTACTGAGTGCTGGGCCAGG - Intronic
946827683 2:223695566-223695588 AGAACAGTGATTTTTGGGCCAGG - Intergenic
948913849 2:241020297-241020319 AGACCAGTGAGTATTGGGGCTGG - Intronic
1170609720 20:17902619-17902641 AGAACAAAGATTGCTGGGGCTGG - Intergenic
1170624394 20:18020379-18020401 AGACAAGGCATGGCTGGGCCGGG - Intronic
1172177299 20:32980209-32980231 AGACCAGGCATGGCTGGGGCAGG - Intergenic
1172426399 20:34859242-34859264 AGATCAGTGGTTGGTGGGGCTGG - Intronic
1172839056 20:37891074-37891096 TGACCCCAGATTGCTGGGCCTGG - Intergenic
1173161211 20:40653801-40653823 CAACCAATGATTGATGGGCCTGG - Intergenic
1174102404 20:48137628-48137650 ACCCCAGTGACTGCTGCGCCAGG - Intergenic
1175739624 20:61411703-61411725 TGAGCAGTGCCTGCTGGGCCTGG + Intronic
1176336247 21:5602471-5602493 AGCCCAGTGCATGCTGGGGCTGG - Intergenic
1176391510 21:6218477-6218499 AGCCCAGTGCATGCTGGGGCTGG + Intergenic
1176406313 21:6370098-6370120 AGCCCAGTGCATGCTGGGGCTGG - Intergenic
1176469909 21:7097697-7097719 AGCCCAGTGCATGCTGGGGCTGG - Intergenic
1176493470 21:7479475-7479497 AGCCCAGTGCATGCTGGGGCTGG - Intergenic
1176507172 21:7658908-7658930 AGCCCAGTGCATGCTGGGGCTGG + Intergenic
1177525970 21:22290070-22290092 AGATCAGTATTTGCTGGGACTGG + Intergenic
1178912332 21:36685460-36685482 TGGCCAGTGAGTGCTGGGGCTGG - Intergenic
1178968383 21:37146671-37146693 AGACCAGTGATTGCTGGGCCTGG + Intronic
1179398586 21:41063225-41063247 ACACCAGTGAATGCTGGCCAGGG - Intergenic
1179968409 21:44819440-44819462 AGCCCACAGATTGCTGGCCCTGG + Intergenic
1181016105 22:20069836-20069858 ACACCAGGAATGGCTGGGCCTGG + Intergenic
1181431296 22:22883278-22883300 ACACCAGTGGTTGGTGTGCCTGG + Intronic
1182454875 22:30443910-30443932 AGAGAAATGTTTGCTGGGCCAGG + Intergenic
1184657958 22:45951557-45951579 AGACTGGTGGTTGCTGGGTCGGG - Intronic
949501952 3:4688451-4688473 AAAGCACTGATTGCTGGGCCAGG - Intronic
949702551 3:6775858-6775880 AGAAAAGTGACTGATGGGCCGGG - Intronic
950883458 3:16342819-16342841 AGTCCAGTGGCTGCTAGGCCTGG + Intronic
951234969 3:20223852-20223874 AGAGCAGTCATTTCTAGGCCTGG + Intergenic
952964539 3:38612980-38613002 AGACTTGTGATTTCTGAGCCTGG - Intronic
953387071 3:42512780-42512802 AGAAAAGTGGTTGCTGGCCCCGG - Intronic
953604063 3:44397314-44397336 AGACCAGTGGTTGCTTGGAGAGG - Intronic
954225413 3:49177883-49177905 AGGCCACTGAGTCCTGGGCCTGG + Exonic
954800055 3:53181871-53181893 AGTTCAGTGAGTGCTGGGGCTGG + Intronic
958195665 3:90239324-90239346 AGAACAATGTTTTCTGGGCCAGG + Intergenic
958525628 3:95256241-95256263 AGAAAAGTCATTGATGGGCCAGG + Intergenic
959926673 3:111929674-111929696 AGACCAGTGGCAGGTGGGCCTGG - Intronic
961463462 3:127067656-127067678 AGGTCAGTGGGTGCTGGGCCAGG - Intergenic
961652701 3:128425195-128425217 AGATGAGTGAATGCTGGGGCCGG - Intergenic
961993140 3:131213629-131213651 AGACCACTGATTTCTGTTCCTGG - Intronic
962250727 3:133834460-133834482 AGACCAGGGAAGGCTGGGCGGGG + Intronic
964397477 3:156260439-156260461 AGATTAGTGGTTGCTGGGGCTGG - Intronic
964931977 3:162036436-162036458 AGAACAGTGATTGCTAGGTTTGG + Intergenic
965612933 3:170563714-170563736 AGACCAGTGTTTGTTGGGCCGGG - Intronic
968546657 4:1202414-1202436 AGAGCGGTGAGTACTGGGCCTGG - Intronic
969267011 4:6071268-6071290 AGACCTGAGACAGCTGGGCCTGG + Intronic
969347914 4:6580739-6580761 AGACCACTGCTTACTGGGCAAGG + Intronic
969666171 4:8558626-8558648 TGGCCAGTGAGGGCTGGGCCTGG - Intergenic
969969673 4:11032732-11032754 AGCCCAGTGGTTGTTGGGCTTGG + Intergenic
971053263 4:22885011-22885033 AGATCAGTTGTTGCTGGGGCTGG + Intergenic
972667713 4:41183206-41183228 ACAATGGTGATTGCTGGGCCAGG - Intronic
973199845 4:47487845-47487867 AAACCTGTGAATGTTGGGCCAGG + Intronic
973232768 4:47861154-47861176 AAAACACAGATTGCTGGGCCGGG - Intronic
973646235 4:52953921-52953943 AGACCATGGACTCCTGGGCCAGG + Intronic
975616433 4:76251881-76251903 AGACCCGCGCTTGCTGGGGCGGG + Intronic
976853442 4:89575991-89576013 AGAGCAGTGGGTCCTGGGCCTGG - Intergenic
977922167 4:102657757-102657779 ATATCAGTGATTGCTGGAACTGG - Exonic
979574952 4:122278918-122278940 AGATCAGTCATGGCTGGGCATGG - Intronic
983979789 4:173981583-173981605 AGACCAGTGATTCCCAGGCCAGG + Intergenic
984824614 4:183913475-183913497 AGAACAGTGTGTCCTGGGCCAGG + Intronic
985587519 5:748628-748650 AGACCAGAGCTTGCTGGGGATGG + Intronic
986002332 5:3640044-3640066 AGAACAGTGATTGCCAGGGCAGG - Intergenic
986009162 5:3696599-3696621 AGGTCAGTGATTGCTTGGCTGGG - Intergenic
986154938 5:5165125-5165147 AGAGGAGTGGTTGCTGGGGCTGG - Intronic
986614950 5:9606562-9606584 AAATCAGGGATTGCTGGGGCAGG - Intergenic
988830078 5:34978530-34978552 AGATCAGTGATTGCTGGGGCTGG + Intergenic
994729613 5:103476407-103476429 AAACCAGTGATTACAGGGCCTGG - Intergenic
997906917 5:137826730-137826752 AAATCAGTGATTGCTAGGCCAGG + Intergenic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
998858391 5:146418502-146418524 AGATCAGTGATTGCTGGGGTTGG + Intergenic
999695290 5:154183480-154183502 AGATCAGTGGTTGCTGGGTTAGG + Intronic
1001020032 5:168174918-168174940 AGAGCAGTGGTAGCTGGCCCTGG + Intronic
1002525407 5:179812873-179812895 AGACTAGCTATGGCTGGGCCTGG - Intronic
1002968301 6:1989786-1989808 AGACCAGGGAAGGCAGGGCCAGG - Intronic
1003304061 6:4910529-4910551 AAGCCAGTGCTTGCTGGGCTGGG + Intronic
1004083754 6:12423060-12423082 AGGCATGTGATCGCTGGGCCAGG + Intergenic
1004385227 6:15166939-15166961 AATTCAGTGATTTCTGGGCCGGG - Intergenic
1004573734 6:16872737-16872759 AGACAGGTAATTGCAGGGCCAGG + Intergenic
1004707820 6:18140987-18141009 AGCCCAGAGATGGGTGGGCCTGG + Intronic
1008007084 6:46422239-46422261 AGGCCAGAGAGGGCTGGGCCGGG - Intronic
1009193460 6:60656708-60656730 AGCCAAGTGATTGCTGGGGGAGG + Intergenic
1011268044 6:85546132-85546154 AGACCAGTGATTGCTTTGGCAGG + Intronic
1011540945 6:88427904-88427926 AGATCAGTGGTTCCTGGGTCTGG - Intergenic
1011552149 6:88539741-88539763 AGAGCAGGGAATGCGGGGCCAGG + Intergenic
1011660312 6:89589110-89589132 AGACCTGTCATTCCTGGGACAGG + Intronic
1014118585 6:117695732-117695754 AGACCAGTGGTTGCTGGTTTAGG - Intronic
1014989905 6:128061657-128061679 AGCCCAGGGATTCCTGGGCAGGG + Intronic
1015982847 6:138856506-138856528 AGACAAAGAATTGCTGGGCCAGG - Intronic
1017315337 6:153024537-153024559 TGACCAGTGAATGCTAGACCAGG + Intronic
1017824395 6:158070890-158070912 AGTGCATTGATTGCTGGGCACGG + Intronic
1017915567 6:158829034-158829056 AGACCAGTGACTACTGGTCTTGG + Intergenic
1017931003 6:158955444-158955466 AGAACGGTGATTGCTGGGGCTGG - Intergenic
1021779901 7:24093551-24093573 ATACCAGTGACGGCTGGGCGCGG - Intergenic
1022967003 7:35483177-35483199 AGACCAGTCCTTGCTGGGGAAGG + Intergenic
1028936378 7:96468917-96468939 AGAGCAGCTCTTGCTGGGCCTGG - Intergenic
1030635651 7:111945474-111945496 ATAACAGTGATTGCGGGGCACGG - Intronic
1033366953 7:140678967-140678989 AGATCTGGGATTGCTGGGGCAGG + Intronic
1033804786 7:144941295-144941317 AGACCTGTGATTTGTGGGCGGGG + Intergenic
1035741981 8:1935464-1935486 AGACCAGTGGTTGCCGAGACTGG - Intronic
1036803281 8:11808648-11808670 AGGCCAGTCCTTGCAGGGCCAGG - Intronic
1038197808 8:25384252-25384274 AGATCAGTGGTTGCTGGCCAGGG + Intronic
1038997318 8:32938895-32938917 AGAGCAGTTATTAGTGGGCCTGG - Intergenic
1039957408 8:42218011-42218033 AGACCAATGGTTCCTGTGCCCGG - Intergenic
1040995932 8:53402361-53402383 AGAACAGAGATTGCAGGGCTGGG - Intergenic
1041401450 8:57449742-57449764 AGAAGTGTGATTGCTAGGCCAGG + Intergenic
1043707422 8:83369307-83369329 AGATCAGAGATTTCAGGGCCTGG + Intergenic
1044741413 8:95330882-95330904 AGAAGAGGGATTGCTGGGTCAGG + Intergenic
1045340823 8:101252927-101252949 TGACCAGTGATTACAGGGGCAGG - Intergenic
1046728006 8:117695251-117695273 AGACCAGTTATTTCAGTGCCTGG + Intergenic
1048333220 8:133485244-133485266 TGACCAGTGATAGCTGGGACGGG + Intronic
1048541234 8:135343959-135343981 AGTCCTGTGAGGGCTGGGCCAGG - Intergenic
1048737470 8:137517805-137517827 GGACCAGGGATTCCTGAGCCAGG + Intergenic
1049743366 8:144251679-144251701 AAAACAGTGATTGATGAGCCAGG - Intronic
1050372322 9:4934437-4934459 AGACTATTTATTGCTGGGCGTGG + Intergenic
1051723466 9:20064290-20064312 AGATCAATGGTTGCTGGGGCTGG + Intergenic
1052342245 9:27375239-27375261 ACTCCAGTGCTTGCTGGGGCTGG - Intronic
1055825740 9:80322201-80322223 AGCCCAGTGAGGGCTGGGCGTGG - Intergenic
1056820841 9:89841107-89841129 AGATCAGTGTGTGCAGGGCCTGG - Intergenic
1057520317 9:95754751-95754773 AGAACTGTGATTGCGGGGGCTGG + Intergenic
1058698565 9:107581521-107581543 AGACGACTAACTGCTGGGCCTGG + Intergenic
1058729829 9:107839071-107839093 AAAGTAGTGATGGCTGGGCCTGG + Intergenic
1059979173 9:119750916-119750938 AAACCACTGGATGCTGGGCCGGG + Intergenic
1060594949 9:124842012-124842034 AAACCAGTGAGTGCCTGGCCCGG - Intergenic
1061025544 9:128046717-128046739 AGACCAGTGACTGCTTGGAGTGG + Intergenic
1062222977 9:135429108-135429130 AGAACGGTGATTGTGGGGCCTGG + Intergenic
1062573537 9:137196234-137196256 AGTGCAGGGATTGCAGGGCCCGG - Intronic
1062724493 9:138064034-138064056 AGACCACTGAGAGATGGGCCTGG + Intronic
1203425396 Un_GL000195v1:32431-32453 AGCCCAGTGCATGCTGGGGCTGG + Intergenic
1186031118 X:5369901-5369923 TGACCAGTGAGTGCTGGTCAAGG - Intergenic
1192236928 X:69301972-69301994 AGACGGGTGGTTGCTGGGGCAGG + Intergenic
1194219359 X:91171836-91171858 ATACCAGTGATGGCTGGGCATGG - Intergenic
1194902612 X:99532291-99532313 AGATCAAGGATTGCTGGGGCTGG - Intergenic
1195003371 X:100663839-100663861 AGACCAGTGCCTGGAGGGCCAGG - Intronic
1195236242 X:102901470-102901492 AGAAGAGAGATTGCTGGCCCCGG + Intergenic
1195609016 X:106842866-106842888 AGATCAGTGATTGCTTGGGTTGG - Intronic
1200272014 X:154694681-154694703 AGATCAGTGTTGGCTGGGCGCGG - Intronic
1200555871 Y:4635599-4635621 ATACCAGTGATGGCTGGGCATGG - Intergenic