ID: 1178969576

View in Genome Browser
Species Human (GRCh38)
Location 21:37160436-37160458
Sequence CAGGTGCAGAATGTCTAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178969574_1178969576 -10 Left 1178969574 21:37160423-37160445 CCCAGTGTCTGGTCAGGTGCAGA 0: 1
1: 0
2: 5
3: 25
4: 164
Right 1178969576 21:37160436-37160458 CAGGTGCAGAATGTCTAGTTTGG 0: 1
1: 0
2: 0
3: 20
4: 175
1178969573_1178969576 -9 Left 1178969573 21:37160422-37160444 CCCCAGTGTCTGGTCAGGTGCAG 0: 1
1: 0
2: 2
3: 22
4: 241
Right 1178969576 21:37160436-37160458 CAGGTGCAGAATGTCTAGTTTGG 0: 1
1: 0
2: 0
3: 20
4: 175
1178969570_1178969576 29 Left 1178969570 21:37160384-37160406 CCATAAGGAGCTGAAGGCTTCTT 0: 1
1: 0
2: 0
3: 19
4: 173
Right 1178969576 21:37160436-37160458 CAGGTGCAGAATGTCTAGTTTGG 0: 1
1: 0
2: 0
3: 20
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178969576 Original CRISPR CAGGTGCAGAATGTCTAGTT TGG Intronic
904821095 1:33245004-33245026 CAGGTGCACAGGGTCTAGTCTGG + Intergenic
907635031 1:56125538-56125560 CAGGTAAAGAATGTTTTGTTTGG + Intergenic
907804758 1:57807096-57807118 CAGTTGCAGAAAGGCCAGTTAGG - Intronic
909531184 1:76683579-76683601 CAAGTGCAGAAGCTCAAGTTGGG + Intergenic
909679987 1:78280987-78281009 CAGGTTAAGAATGTCTCTTTTGG + Intergenic
910782374 1:90953497-90953519 CATGTGCAGGATGTGTAGGTTGG - Intronic
911167203 1:94734929-94734951 AAGGTGAAGAATCTCCAGTTTGG + Intergenic
912536251 1:110374633-110374655 CAAGTACAGAATGTCTAATTAGG + Intronic
913031037 1:114902699-114902721 CAGGATCAGAATGTCTTGATTGG + Intronic
914400261 1:147312772-147312794 CATGTGCAGAATGTATACATAGG - Intergenic
915378108 1:155415859-155415881 CAGGTTCAGAAGGTTTAGCTGGG + Exonic
915541765 1:156571986-156572008 CAGTTCCAGAAGGTCTGGTTTGG - Intronic
920440345 1:205976378-205976400 AAGGTGCAAAATGTGTGGTTTGG + Intergenic
921856277 1:219988685-219988707 CAGGTTCAGAATTTCTGGTTGGG + Exonic
922903616 1:229157302-229157324 CAGCTGCAGAGTGGCTTGTTGGG - Intergenic
924734557 1:246744101-246744123 CAGGTCCTGAATGTATAGTCAGG - Exonic
1065734518 10:28739405-28739427 CAGGTGCATACTGTGAAGTTAGG - Intergenic
1066269197 10:33805521-33805543 CAGGTGCAGAAAGACTAACTTGG + Intergenic
1068152355 10:53149250-53149272 CTGATTCATAATGTCTAGTTTGG - Intergenic
1068408724 10:56626753-56626775 CAGGTGAAGAGAGTCTAGTCAGG + Intergenic
1069252397 10:66286013-66286035 CATTTGCATAATGTTTAGTTTGG + Intronic
1069337873 10:67374672-67374694 CAGGTAAATAATGTCTAGTGAGG + Intronic
1070246198 10:74733601-74733623 CAGGTGCAGAGTTTCTGTTTGGG - Intergenic
1071059877 10:81557225-81557247 CAGGTGCAGAATGTGCAGGTTGG + Intergenic
1072133735 10:92522963-92522985 AAGGTGCTGAAAGTTTAGTTGGG - Intronic
1077477946 11:2799745-2799767 CAGGAGCAGAATTTCTGGGTTGG + Intronic
1078100603 11:8328391-8328413 CAGGTGCAGCATGTCCAGGCTGG + Intergenic
1078279527 11:9886255-9886277 AAGTTGCAGAATTTCTACTTTGG - Intronic
1079103131 11:17553645-17553667 CAGGTGCAGACTGCCTGGGTGGG - Intronic
1079997483 11:27309875-27309897 CAGGTTCATGGTGTCTAGTTAGG - Intergenic
1080258410 11:30319675-30319697 CAGGTGTAGAAAGTCAAGTAAGG - Intergenic
1080603826 11:33847319-33847341 AAGCTGGAGAATGTTTAGTTTGG - Intergenic
1081118713 11:39236883-39236905 CATGTGCAGAATGTGCAGGTTGG - Intergenic
1081555278 11:44154388-44154410 CAGGTGCAGAAAGACAACTTTGG - Intronic
1081585270 11:44379923-44379945 CAGGTGCTGAATCTCAAGCTGGG - Intergenic
1084838508 11:71825440-71825462 CAGTTACAGAATTTCTAGTTTGG + Intergenic
1087593853 11:100228656-100228678 CAGGTGCTGAATGAATAGGTGGG - Intronic
1091981351 12:4866631-4866653 CAGGTGCAGAGTGGCTGGTAGGG + Intergenic
1092329037 12:7565849-7565871 CATGTGCAGAATGTGCAGGTTGG - Intergenic
1092400181 12:8168656-8168678 TAGTTACAGAATTTCTAGTTTGG - Intronic
1095683485 12:45005473-45005495 CAGTTGCAGAAGGTATAGTAAGG - Intergenic
1096062803 12:48716388-48716410 CAGAAGCTGGATGTCTAGTTGGG - Intronic
1098502673 12:71211773-71211795 GAGGTGCAGAATGGCTGGATTGG - Intronic
1098771141 12:74554520-74554542 CAGGTACAGAATGTTTTGTGGGG + Intergenic
1100703306 12:97172398-97172420 CAGCTGCAGAAAGTGGAGTTCGG - Intergenic
1100760743 12:97804239-97804261 GAGGTACAGAATGGCTAGGTTGG + Intergenic
1105274366 13:18906075-18906097 CAGGTGCACAATGTTTCCTTGGG + Intergenic
1105609232 13:21953529-21953551 AAGGTTTAGAATGTCTATTTTGG + Intergenic
1107437984 13:40398273-40398295 CAGGGGCAGAATTTCTGGTTGGG + Intergenic
1108329626 13:49372351-49372373 CATGTGAATAATGGCTAGTTAGG - Intronic
1108812529 13:54245985-54246007 CAGGTGAAGGATGTTAAGTTAGG - Intergenic
1114687454 14:24547690-24547712 CAGGGGCAGAATGTATGGCTTGG - Intergenic
1115134166 14:30089340-30089362 GAGGTGAAGAATGTGTATTTTGG - Intronic
1115486669 14:33917190-33917212 CATGTGCAGAACGTCTGGTATGG - Intergenic
1117341236 14:54793761-54793783 CATGTGCAGAATGGCCAGGTGGG - Intergenic
1118110992 14:62719609-62719631 GAGGTACAGAATGGCTAGATTGG + Intronic
1123498976 15:20862550-20862572 CAGGTGCAGGATGTGCAGGTTGG + Intronic
1123556212 15:21436169-21436191 CAGGTGCAGGATGTGCAGGTTGG + Intronic
1123592452 15:21873515-21873537 CAGGTGCAGGATGTGCAGGTTGG + Intergenic
1125494997 15:40184890-40184912 AAGATGCAGAATGTCTTTTTTGG + Intronic
1125575775 15:40754771-40754793 CAGGTGCAGCATGTCTAGACTGG - Exonic
1126742761 15:51794579-51794601 CAGGTGAATAATGTGCAGTTAGG - Intronic
1127844930 15:62861621-62861643 CATGTGCACAATGTGCAGTTTGG - Intergenic
1130214398 15:81954548-81954570 CAGGTGCAGAATGGTCAGGTTGG + Intergenic
1130889164 15:88118787-88118809 GAGGTGCAGAATGTCTAAACTGG + Intronic
1202964553 15_KI270727v1_random:163372-163394 CAGGTGCAGGATGTGCAGGTTGG + Intergenic
1133595372 16:7286181-7286203 CATGTTCAGAATGTCTAGCATGG + Intronic
1133635379 16:7660111-7660133 CACGAGCAGATTGTATAGTTTGG + Intronic
1134180469 16:12043651-12043673 CAGGTGCAGAATTTTAATTTGGG + Intronic
1135307213 16:21377412-21377434 CAGGTGCAGAATTTTAATTTGGG + Intergenic
1136303959 16:29356550-29356572 CAGGTGCAGAATTTTAATTTGGG + Intergenic
1137803393 16:51282212-51282234 CAGGAGCAGAATGTCTGCTCTGG - Intergenic
1138358892 16:56409457-56409479 CAGGTGCAGAAAGACAAGTCCGG + Exonic
1142138191 16:88461067-88461089 CAGGGGCAGAAGGTCTGGTGAGG + Intronic
1144961089 17:19044577-19044599 CAGATGGAGAATGTCTGGTTGGG + Intronic
1144974072 17:19129947-19129969 CAGATGGAGAATGTCTGGTTGGG - Intronic
1145921033 17:28610312-28610334 CAGTAGCAGAATGTCCAGGTTGG + Intronic
1146314925 17:31799376-31799398 CAGCTTCAGAATGTCTGATTTGG + Intergenic
1146379534 17:32318689-32318711 CAGGTGCTTACTGTCTAGCTTGG - Intronic
1147443691 17:40462363-40462385 CAGCTGCAGATTGTCAAGTGGGG + Intergenic
1149356965 17:55849209-55849231 TAGCTGCAGAATTTCTATTTTGG - Intergenic
1149640481 17:58199546-58199568 CAGGGGCAGAAAGTCTCGGTAGG - Exonic
1152657943 17:81528553-81528575 CAGGTGCTGAAGATCCAGTTTGG + Exonic
1153109782 18:1571828-1571850 CTAGTTCAGAAAGTCTAGTTAGG + Intergenic
1154457017 18:14539296-14539318 CAGGTGCAGGATGTGCAGGTTGG + Intronic
1154466056 18:14643330-14643352 CAGGTGCACAATGTTTCCTTGGG + Intergenic
1155042533 18:22076563-22076585 CAGCTGCAGTAGGTCTAGTTTGG + Intergenic
1155074816 18:22345449-22345471 AAGGTGCAGAAGGGCTAGTGAGG + Intergenic
1155707719 18:28837487-28837509 CAGGGGCAGAATGATTGGTTTGG - Intergenic
1158296649 18:56003805-56003827 CAGGTGCATGCTGTCTGGTTTGG - Intergenic
1158321830 18:56271827-56271849 CACATGCAGAATATCTTGTTTGG + Intergenic
1163071272 19:14844033-14844055 CATGTGCAGAATGTGCAGTTTGG - Intergenic
1164610750 19:29629998-29630020 CAGGATCAGATTGTCAAGTTTGG + Intergenic
1167400238 19:49261710-49261732 CAGGTGCAGAGTTTCTATTTGGG + Intergenic
929249981 2:39742659-39742681 TAGATGCAGATTATCTAGTTAGG + Intronic
929436813 2:41934911-41934933 CAGGGACAGAATGTCTAGGAGGG + Intergenic
933290429 2:80432467-80432489 CAGCTCCAGAATGTCTAAATAGG - Intronic
934635604 2:95985882-95985904 CAAGTCCAGAATGTCTTGATGGG - Intronic
934798021 2:97119365-97119387 CAAGTCCAGAATGTCTTGATGGG + Intronic
934835401 2:97584073-97584095 CAAGTCCAGAATGTCTTGATGGG - Intronic
934998115 2:98985280-98985302 CATGTGCAGGATGTGTAGGTTGG + Intergenic
936777960 2:115996700-115996722 CACGTGCAGAATGTGCAGGTTGG + Intergenic
937184678 2:120029084-120029106 CAGTTGGAGAATGGCTGGTTAGG + Intronic
939040535 2:137184107-137184129 CAGGTTCAGTGTGTCTAGTGAGG + Intronic
939566866 2:143795436-143795458 CAGCTGCAGAATGCCTAATTGGG + Intergenic
942228853 2:173840960-173840982 CAGGAGCAGAATTTCTAGTCTGG - Intergenic
943871356 2:193005167-193005189 CACGTGCAGAATGTGCAGGTTGG + Intergenic
946525239 2:220511253-220511275 CAGGTGCAGAAAGTATGGTAAGG - Intergenic
947381391 2:229548697-229548719 CATGTGCAGAACGTGCAGTTTGG - Intronic
947521052 2:230846351-230846373 CAGGTACAGCATGACTAGTTAGG + Intergenic
948148691 2:235727878-235727900 GGGGTGCAGCATGTCTAGTTTGG + Intronic
948403072 2:237698398-237698420 CAGGTGCAGACTGTCAAGAAAGG - Intronic
1168917687 20:1504728-1504750 CGGCAGCAGAATGTCTAGCTAGG + Intergenic
1169868147 20:10222442-10222464 CATATGCAGAATATCAAGTTAGG + Intronic
1170885306 20:20335688-20335710 CAGGTAGAGAAGGTCTAGATGGG - Intronic
1171214332 20:23341448-23341470 CACCTGAAGAATGTCTAGATGGG - Intergenic
1171764902 20:29255281-29255303 CATGTGCACAATGTGCAGTTTGG - Intergenic
1176013596 20:62915017-62915039 CAGGTGCCGAGTTTCTAGCTAGG + Intronic
1176808529 21:13515266-13515288 CAGGTGCACAATGTTTCCTTGGG - Intergenic
1176817141 21:13614041-13614063 CAGGTGCAGGATGTGCAGGTTGG - Intronic
1177357001 21:20021543-20021565 CATGTGCAGAATGTGCAGGTTGG + Intergenic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1178969576 21:37160436-37160458 CAGGTGCAGAATGTCTAGTTTGG + Intronic
1180197784 21:46207884-46207906 CAGGTGCAGACTGTGAAATTAGG - Intronic
1184180361 22:42819107-42819129 CCGGTGCAGAATTTCTTATTAGG + Intronic
950225111 3:11227079-11227101 CAGGAGCAGAAAGACCAGTTAGG + Intronic
952828153 3:37541042-37541064 CAGGTGCAGAATGCCCATTCAGG + Intronic
955685227 3:61542779-61542801 CATGTGAAAAATGTCTAGCTGGG + Intergenic
957096456 3:75781178-75781200 CAGGTGCATACTCTCAAGTTAGG - Intronic
957700142 3:83699937-83699959 CATGTGCAGAATGTGCAGGTTGG + Intergenic
957842484 3:85689572-85689594 TAGGTGCAGAAAGACAAGTTAGG + Intronic
959128220 3:102317413-102317435 CAGGTGCTGAAGGGCTAATTTGG - Intronic
965018098 3:163186912-163186934 CAGGGGCAGAATGACAACTTAGG - Intergenic
967821814 3:193845654-193845676 CAGAGGCAGAATGTGTGGTTGGG - Intergenic
969779930 4:9392922-9392944 TAGTTACAGAATTTCTAGTTTGG + Intergenic
970278946 4:14432959-14432981 CATGTGCAGAATGTGCAGGTTGG - Intergenic
970684691 4:18553605-18553627 GAGGTACAGAATGTCTGGATTGG - Intergenic
974308791 4:60176267-60176289 CAAGTGCAGAATATGCAGTTTGG - Intergenic
974972754 4:68849630-68849652 CATGTGCAGAATGTGCAGGTTGG - Intergenic
975786261 4:77891840-77891862 CAGGTACAGAATTTCTCTTTAGG + Intronic
976471594 4:85435266-85435288 CAGGTCCTGAGTGTATAGTTTGG - Intergenic
977988200 4:103410598-103410620 CAGGTGGAAAGTGTCAAGTTGGG + Intergenic
980448300 4:132939979-132940001 CAGCTGTAGAATTTCTAATTTGG - Intergenic
980851235 4:138384843-138384865 CATGTGCAGAATGTCTTTCTAGG - Intergenic
982923138 4:161302096-161302118 CAGGTGCAGAATGACAAATATGG - Intergenic
985001731 4:185491790-185491812 CAGGTGCAAAATGACAAGTAAGG + Intergenic
986292355 5:6410391-6410413 CAGGTGGAGAATGCCTGGATGGG - Intergenic
987255687 5:16148485-16148507 CAAGTGCAGAATGGCAGGTTTGG + Intronic
987945458 5:24602570-24602592 AAGTTGCAGAATGTCTAATTGGG - Intronic
989212942 5:38874965-38874987 CATGTGCAGAATGGCAATTTGGG + Intronic
989243903 5:39231815-39231837 CAGCTGCACCCTGTCTAGTTGGG + Intronic
990859472 5:60310860-60310882 CACTTGCAGAATTTCTTGTTTGG - Intronic
990868874 5:60409335-60409357 CAGGAGCAGAAAGTCTTGTGTGG + Intronic
991174727 5:63673884-63673906 CATGTGCCAAATGTCTTGTTAGG + Intergenic
996337698 5:122402708-122402730 CAAGTGAAGAATGTGTAATTAGG - Intronic
997785735 5:136711366-136711388 CATGTTTAGAATGTTTAGTTAGG + Intergenic
998443042 5:142178005-142178027 AAGGTGCTCACTGTCTAGTTTGG + Intergenic
999282261 5:150373664-150373686 CATGTGCAGAAAGTCCAGTGAGG + Intronic
1002001472 5:176198776-176198798 CATGTGCAGAATGTGCAGGTTGG - Intergenic
1002049512 5:176562206-176562228 TATGTGCAGAAGGACTAGTTTGG + Intronic
1006303844 6:33207695-33207717 CAGGGGCAGAATGTCTGGAGTGG - Intergenic
1008723133 6:54382610-54382632 CAGGTGTTGTATCTCTAGTTAGG - Intronic
1010379760 6:75210648-75210670 AAGGTGGAGAATTTCTAGTCAGG + Intergenic
1012765693 6:103363911-103363933 CAGGTGCAAATTGTATGGTTTGG + Intergenic
1013031461 6:106337301-106337323 CTGGTGCAGAATGTCAATTGTGG - Intergenic
1015507363 6:134002993-134003015 CAGCAGCAGAATGTCTAGTGTGG + Intronic
1016411548 6:143788413-143788435 CAGATACAGAATGGCTGGTTTGG - Intronic
1016808622 6:148238011-148238033 CAAGTGCAGAAGCTCTAGCTAGG - Intergenic
1021151025 7:17151044-17151066 CAGCTGTAGAATCTCTATTTAGG + Intergenic
1022498290 7:30866740-30866762 CAGTTGCAGAGGGTCTAGTTGGG + Intronic
1023036405 7:36135224-36135246 TAGGTGCAGAGTTTCTATTTGGG + Intergenic
1023333206 7:39140909-39140931 CAGAGGCAGGATGTCTGGTTAGG + Intronic
1023648320 7:42342349-42342371 CATGTGCAGAATGTGCAGGTTGG - Intergenic
1031006808 7:116482759-116482781 CAGCTGCAGAATGTCCAGCTAGG - Intronic
1033831709 7:145262723-145262745 AAGGTTCAGAATGTAAAGTTGGG + Intergenic
1036343982 8:7943436-7943458 TAGTTACAGAATTTCTAGTTTGG - Intronic
1036839324 8:12104203-12104225 TAGTTACAGAATTTCTAGTTTGG - Intergenic
1036861113 8:12350446-12350468 TAGTTACAGAATTTCTAGTTTGG - Intergenic
1041085182 8:54250123-54250145 CAGATGCAGAAGGTCAAGTCGGG - Intergenic
1045398493 8:101785912-101785934 CAGCTGCAGAATGTCTCTTCTGG + Intronic
1046789426 8:118305252-118305274 CAGGTTCAGAGTTTCTACTTGGG - Intronic
1052021858 9:23534127-23534149 CATGTGCAGAATGTGCAGGTTGG - Intergenic
1055706229 9:79007819-79007841 CAGTTTCAGTATGTCGAGTTTGG - Intergenic
1059630596 9:116117721-116117743 CATGTGCAGAATGTGCAGGTTGG + Intergenic
1203530222 Un_GL000213v1:135450-135472 CAGGTGCAGGATGTGCAGGTTGG + Intergenic
1185676130 X:1850888-1850910 GAGATGCTGAATGTCTAGTAAGG + Intergenic
1190139994 X:47834563-47834585 CAGGGGCAGAATGACAAGCTGGG + Intergenic
1190968771 X:55328957-55328979 CAGATGCATGGTGTCTAGTTTGG - Intergenic
1191674979 X:63784636-63784658 GAGTTGCAGAAAATCTAGTTGGG + Intronic
1191991209 X:67038869-67038891 CAGGTCCAGAATTTCTATCTAGG + Intergenic
1193314324 X:80046496-80046518 CAGAAGCAGAATAACTAGTTTGG + Intergenic
1196481075 X:116149606-116149628 CATGTACAGAATGTATTGTTTGG - Intergenic
1198332779 X:135637074-135637096 CAGTTTCAGAATGCATAGTTGGG + Intergenic
1198365303 X:135933933-135933955 CAGTTTCAGAATGCATAGTTGGG + Intergenic
1200208009 X:154331912-154331934 CAGGTGCAAAATGTCAGGTTTGG + Intergenic
1202585107 Y:26415350-26415372 CAAGTCCAGAATGTCTTGATGGG + Intergenic