ID: 1178970046

View in Genome Browser
Species Human (GRCh38)
Location 21:37166232-37166254
Sequence CTGGTGTACTGGGGCAAACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 2, 1: 0, 2: 1, 3: 4, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178970046_1178970050 -6 Left 1178970046 21:37166232-37166254 CCAGGTTTGCCCCAGTACACCAG 0: 2
1: 0
2: 1
3: 4
4: 116
Right 1178970050 21:37166249-37166271 CACCAGCATATATACACCCTTGG 0: 2
1: 0
2: 0
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178970046 Original CRISPR CTGGTGTACTGGGGCAAACC TGG (reversed) Exonic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900617681 1:3572655-3572677 CTGGTGTACTGGGTCCTCCCAGG + Intronic
901311925 1:8276056-8276078 CTGGTGGTCTGGGGCATGCCAGG + Intergenic
903473311 1:23602468-23602490 CTGGTGTACAGTGGGAAGCCTGG + Intronic
908291970 1:62676766-62676788 CTGGTGTCACAGGGCAAACCAGG + Intronic
910036106 1:82790949-82790971 CAGGTGGGCTGGGGCACACCTGG + Intergenic
910965608 1:92805269-92805291 CTGGAGTGCTGTGGCAAAACAGG - Intergenic
911182692 1:94875309-94875331 CTAGTGGACTGGTGAAAACCTGG - Intronic
911973821 1:104466879-104466901 ATGGTATACTGGGGTAAACGAGG - Intergenic
917732256 1:177886482-177886504 CTGCTGTTCTGGGGCAAACTTGG - Intergenic
917935105 1:179858847-179858869 ATGGTGACCTGGGGAAAACCTGG + Intronic
918010273 1:180580443-180580465 CTGGGGGAATGAGGCAAACCAGG - Intergenic
921747413 1:218753767-218753789 ATGGTATACTGGGGTAAACAAGG - Intergenic
922514556 1:226197271-226197293 CTGCAGAGCTGGGGCAAACCTGG + Intergenic
922738963 1:228005196-228005218 TTGTGGTACTGGGGAAAACCTGG - Intergenic
924540969 1:244980482-244980504 CTACTATACTGGGACAAACCTGG - Intronic
924667788 1:246091132-246091154 CAGGCGTACTGGGGAAAACATGG + Intronic
924934823 1:248758890-248758912 CTGCTGAGCTGAGGCAAACCTGG + Intergenic
1068341610 10:55711619-55711641 CTAGAGTTCTGGGACAAACCCGG + Intergenic
1074086089 10:110209907-110209929 CTGGGGTAGGGGGGCAAGCCAGG - Intronic
1075589685 10:123682375-123682397 CTTGTGTACTGGGGCACACGAGG + Intronic
1085518649 11:77125758-77125780 CTGGGATACAGGGGCACACCAGG + Exonic
1088707531 11:112477357-112477379 CTGGTGGAGTGGGGCCAAGCTGG - Intergenic
1091084290 11:132705541-132705563 CTGGTGTGCAGTGGCAAATCTGG - Intronic
1093454234 12:19349165-19349187 CTGCTGTACTGGAGCAAACATGG + Intronic
1098798379 12:74922490-74922512 AAAGTCTACTGGGGCAAACCTGG - Intergenic
1099505437 12:83470507-83470529 CTGGTGGACTTGGGAACACCTGG + Intergenic
1099826982 12:87789059-87789081 CGGATCTACTGGGGCAAGCCTGG + Intergenic
1101092839 12:101305129-101305151 CTGGTTTTCTGGAGAAAACCAGG + Intronic
1103665232 12:122558914-122558936 CTGGGGGACTGGGGCAAATGGGG - Intronic
1106247712 13:27963145-27963167 CTGGGGTTCTGGGGCCAACTGGG - Exonic
1108130378 13:47293037-47293059 CTGGAGTACTGTGGAAAACAAGG - Intergenic
1112309677 13:98307403-98307425 CTGGGGTGGTGGGGGAAACCGGG - Intronic
1118440626 14:65808484-65808506 CAGGTGGGCTGGGGCACACCTGG - Intergenic
1124832236 15:33160321-33160343 CTGGAGGACTGAGCCAAACCAGG + Intronic
1126893064 15:53227162-53227184 CTGGTGTACTGGCGCATATTAGG - Intergenic
1127765741 15:62184348-62184370 CAGGTGTACTAGGCCAAACTTGG - Intergenic
1128552835 15:68609335-68609357 CTGGTGAACTGAGTCACACCAGG + Intronic
1131629820 15:94164915-94164937 CTGGTGTAGTGGTGCAGAACAGG - Intergenic
1132593226 16:735588-735610 CTGGTGTCCCAGGGAAAACCTGG - Intronic
1133676661 16:8079726-8079748 CTGGGGTTCTGGGGAACACCTGG + Intergenic
1136066818 16:27765064-27765086 CTGCTGTACTGGGAGAAACTTGG - Intronic
1137703636 16:50518080-50518102 ATGGTTCACTGGGGCAGACCTGG + Intergenic
1140979542 16:80093623-80093645 CTGCTTTCTTGGGGCAAACCTGG - Intergenic
1141629268 16:85277835-85277857 CTGGTGTCCTGGGGCCGGCCTGG - Intergenic
1142424007 16:89991115-89991137 CTGGTGCACTGAGGCAAAATGGG + Intergenic
1147871623 17:43591711-43591733 CTGGGGGGCTGGGGGAAACCTGG + Intergenic
1148435569 17:47681790-47681812 CTGGTGTGGTGGTGCACACCTGG - Intronic
1149686870 17:58540773-58540795 CCAGTGGACTTGGGCAAACCTGG + Exonic
1150235576 17:63590328-63590350 CTGATGGACTGCGGCAATCCTGG + Exonic
1158413125 18:57225285-57225307 CTTGTGTTCTGGGACACACCTGG + Intergenic
1160067283 18:75587453-75587475 CTGGTGAACTTGGGCACAACTGG - Intergenic
1164552155 19:29220896-29220918 CTGGTGGACTTGGGCAGACCTGG + Intergenic
1167417277 19:49381560-49381582 CTGGGGTAATGGAGCAAATCCGG + Intergenic
925858077 2:8149740-8149762 GTGGTGTCCTGGGGCAAAGTGGG - Intergenic
932926572 2:75982158-75982180 ATGGCCTACTGGGGCAAAGCAGG - Intergenic
935806054 2:106748672-106748694 CTAGTGTCCTGGGGCACATCGGG - Intergenic
936432013 2:112473067-112473089 GTGGTGCTCTGGGGCCAACCAGG - Intergenic
937136771 2:119560146-119560168 CTGGTGACCTGGGGAACACCCGG - Intronic
937291345 2:120784067-120784089 ATGGTGTGCGGGGGCAATCCAGG + Intronic
941274605 2:163475141-163475163 CTGCAGTTCTGGGGCAAAGCTGG - Intergenic
941543969 2:166822101-166822123 GTTGTATAGTGGGGCAAACCTGG + Intergenic
1168844736 20:936267-936289 CAGGTGTAGTGGTGCACACCTGG + Intergenic
1173779487 20:45742813-45742835 CTGGAGAACTTGCGCAAACCAGG + Intergenic
1173867207 20:46319990-46320012 CAGGTGTTCTGGGGCAGAGCTGG + Intergenic
1174351444 20:49971111-49971133 AGGGTGTTCTGGGGCAATCCTGG - Intergenic
1174544335 20:51314135-51314157 CTGGTGTTCAAGGGCAATCCAGG + Intergenic
1175924354 20:62464748-62464770 CTGCTGTGCTGGAGCAAAGCAGG + Exonic
1176016930 20:62938489-62938511 CTGGTGTTCTGGGGCGGTCCCGG + Intronic
1178970046 21:37166232-37166254 CTGGTGTACTGGGGCAAACCTGG - Exonic
1179009404 21:37544477-37544499 CAGGTGTAGTGGCGCACACCTGG + Intergenic
1180833476 22:18918419-18918441 CTGGTGTTTTGGGGCCAAGCTGG - Exonic
1181044557 22:20208380-20208402 CTGGCGAGCTGGGGCAAGCCTGG - Intergenic
1181066351 22:20307836-20307858 CTGGTGTTTTGGGGCCAAGCCGG + Intergenic
1182014341 22:27026492-27026514 ATGGTGTTTTAGGGCAAACCTGG - Intergenic
1182623035 22:31628162-31628184 CCTGTGTCCTGGGGCAAAGCTGG - Exonic
1183768380 22:39900628-39900650 ATGCTGGACTGTGGCAAACCTGG + Intergenic
1203283561 22_KI270734v1_random:143717-143739 CTGGTGTTTTGGGGCCAAGCTGG - Intergenic
953524395 3:43676407-43676429 CTGGAGTGCAGGTGCAAACCTGG - Intronic
955347167 3:58169772-58169794 CTGGTGGACTGCAGCAAAGCTGG + Exonic
957767728 3:84648046-84648068 GTGGTCTACTGGGGCAGAGCTGG - Intergenic
961457967 3:127033566-127033588 CTGGGGTCCTGGGGCTCACCAGG + Intronic
967103845 3:186239446-186239468 CTGGTGTAATGGGGTAACCATGG + Intronic
967615899 3:191566146-191566168 CAGGTGGACTGGAGTAAACCTGG + Intergenic
969467968 4:7368803-7368825 CAGGTGTCCTGGGAGAAACCCGG + Intronic
979487258 4:121283524-121283546 CTGGGGCCCTGGGGCAGACCTGG - Intergenic
983181915 4:164657749-164657771 CTGCTGAACTGGGGCATGCCAGG - Intergenic
983559538 4:169086992-169087014 CAGGTGCACTGGGGCATGCCTGG + Intergenic
984567592 4:181349357-181349379 CTGGTGTACATGGTGAAACCCGG - Intergenic
988865058 5:35325038-35325060 CTGGTTTGCTGGTGCAAACGAGG + Intergenic
995379649 5:111517878-111517900 CTGGTGTCCAGGGGGAAACAGGG + Intergenic
998375407 5:141687262-141687284 CTGGAGAACTGGGGCAGCCCTGG + Intergenic
999838907 5:155403231-155403253 CTGGTGAAGTGGGGGAAAGCTGG - Intergenic
1001600205 5:172923563-172923585 CTAGGGCACTGGGGCAAACTTGG + Intronic
1002090995 5:176806181-176806203 CTGGTAGATTGGAGCAAACCTGG + Intergenic
1002176801 5:177405269-177405291 CTGGGGGACAGGGGCAACCCTGG - Intronic
1002698945 5:181109127-181109149 CGGGTGTGCTGGGGCTGACCTGG + Intergenic
1004041580 6:11983579-11983601 CAGGTGAACTGGGGCAAACCTGG + Intergenic
1006424546 6:33956040-33956062 CTGAGGGTCTGGGGCAAACCTGG + Intergenic
1007860007 6:44898703-44898725 CTGGTGTGCTTGTGCACACCTGG + Intronic
1010381576 6:75231679-75231701 CTTGTGTCCTGGGGCAGAGCTGG - Intergenic
1016894837 6:149041530-149041552 CTGGTGTGCAGGGGCTACCCTGG - Intronic
1020401864 7:7788006-7788028 CTGGTGCATTGCGGCAAACATGG - Intronic
1024385999 7:48752556-48752578 ATGGTGTAGTGGAGAAAACCAGG - Intergenic
1024648133 7:51385593-51385615 CTGCTGTGCTGGGGGAAAGCTGG + Intergenic
1026852768 7:73735424-73735446 CTGGAGCACTGGGGGACACCCGG + Intergenic
1027371892 7:77514964-77514986 ATGGTGTGTTGGGGCAAACAGGG + Intergenic
1029380673 7:100212337-100212359 CTGGTGTAGTGGGAAAAGCCTGG + Intronic
1032478499 7:132228238-132228260 CTGGAGGACTGGGCCAAGCCCGG - Intronic
1038648079 8:29377861-29377883 CTGGTGTCCTGGGCCCAGCCAGG - Intergenic
1039899426 8:41740804-41740826 CTGGGATACAGGCGCAAACCAGG + Intronic
1046690871 8:117282905-117282927 CAGGTGGGCTGGGGCATACCCGG + Intergenic
1047497207 8:125416967-125416989 TTTGTGTATTGGGACAAACCTGG - Intergenic
1049017987 8:139934894-139934916 CTTGTGGGCTGGGTCAAACCAGG + Intronic
1049192641 8:141297081-141297103 CTGGTTCAGTGTGGCAAACCTGG - Intronic
1055871540 9:80886483-80886505 CCAGTGTACTGTGGCACACCTGG + Intergenic
1056658957 9:88530916-88530938 TTGGTGTCCTGGGCCACACCTGG - Intergenic
1061894723 9:133641271-133641293 GGGGTGTGCTGGGGCAGACCTGG + Intronic
1062630451 9:137460921-137460943 GTGATGTGCTGGGGCAAAGCTGG - Intronic
1188854189 X:35171866-35171888 CTACTGTACTGTGGCTAACCTGG + Intergenic
1192924651 X:75742875-75742897 CTGGTGTACTGGGGCAAACCTGG + Intergenic
1198825389 X:140693259-140693281 ATGGGGTAATGGGGAAAACCTGG - Intergenic
1199005784 X:142694185-142694207 CTGTTGTACTGTGGCTAATCTGG - Intergenic