ID: 1178971582

View in Genome Browser
Species Human (GRCh38)
Location 21:37182692-37182714
Sequence CTGAAAGGCTAGAATTGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178971582 Original CRISPR CTGAAAGGCTAGAATTGTGA CGG (reversed) Intronic
901590145 1:10334377-10334399 CTGAGAGGCTAGGACTGAGAAGG + Intronic
907721112 1:56973212-56973234 CAGAAATGCTAGAAATGTGTGGG + Intergenic
909918512 1:81351118-81351140 CTGAAAGTCAAGATTTGTAATGG - Intronic
911276737 1:95869649-95869671 ATGAAAGGCTAGAATTGGTTTGG - Intergenic
912420864 1:109541502-109541524 CTGTAAGGCTATAACTGTGGAGG + Intronic
912789481 1:112638064-112638086 TAAAAGGGCTAGAATTGTGAAGG + Intronic
912851699 1:113131371-113131393 CAGAAATGCTAGAAGTGTAAAGG + Exonic
913978940 1:143490298-143490320 CTCAAAGGCCAGAAATGTCAAGG - Intergenic
914073345 1:144315947-144315969 CTCAAAGGCCAGAAATGTCAAGG - Intergenic
914105809 1:144650413-144650435 CTCAAAGGCCAGAAATGTCAAGG + Intergenic
917980839 1:180267977-180267999 CTGAAAGGCCAGAGCTGTGGGGG - Intronic
920130893 1:203731036-203731058 CTTAGAGACTAGAATTGTGGAGG + Intronic
920700073 1:208211296-208211318 CTTAAAGGCTGGAAATATGAAGG - Intronic
922653606 1:227361867-227361889 CAGAAAGGCTAAAATTGACAAGG - Intergenic
924558458 1:245137498-245137520 CTGGAAGGCTAGAGGTGCGAAGG + Intergenic
924937921 1:248788121-248788143 GAGAAAGGTTAGAATGGTGAAGG + Intergenic
1063376286 10:5556530-5556552 CTAAAAGGCTTGAATTTGGAGGG - Intergenic
1069910589 10:71756713-71756735 GGGAAAGGCTAAAATTGGGAAGG - Intronic
1074966152 10:118492430-118492452 TTGCAAGGCTAGAAATGTAAGGG + Intergenic
1075888156 10:125920278-125920300 CTCAAAGGCCAGAAATGTCAAGG - Intronic
1082626524 11:55494207-55494229 CTGAAAGTCTTGAACAGTGAGGG + Intergenic
1083114251 11:60443491-60443513 CTCAAAGGCAAGTATTGGGAAGG + Intronic
1085887373 11:80536328-80536350 CTGAAAGGCTGGCAGTGTGAGGG - Intergenic
1085995328 11:81905511-81905533 CTGAAAAGCTATAATTGCCATGG - Intergenic
1086290334 11:85301540-85301562 ATGCAGGGCTAGAACTGTGAGGG + Intronic
1086730104 11:90238200-90238222 CAGAAAGGCTAAAATTTTTAAGG - Intergenic
1087022629 11:93618512-93618534 CTGAAGGGCTAGTATAGGGATGG - Intergenic
1090488828 11:127139922-127139944 CTCAAACTCTAGAATTGTGCTGG + Intergenic
1090975480 11:131676577-131676599 CTGAAAATATGGAATTGTGAAGG - Intronic
1095182044 12:39157477-39157499 CAGAAAGGATATCATTGTGAGGG + Intergenic
1095378123 12:41556254-41556276 ATGAAAGTCTAGAAGTTTGAAGG + Intronic
1096456076 12:51788135-51788157 CTGAAGGAGTAGAATTGGGAAGG + Intronic
1097201537 12:57283085-57283107 CTAATAGGCTAGAATTTAGAGGG - Intronic
1099118581 12:78659755-78659777 CTGACTGGATAGAATTTTGAAGG - Intergenic
1105220392 13:18321096-18321118 CTCAAAGGCCAGAACTGTCAAGG + Intergenic
1105959486 13:25317396-25317418 CAGGAAGGCAAGAATTGTCATGG + Intronic
1106783930 13:33088469-33088491 CTTAAAGTTTAGAACTGTGAAGG + Intergenic
1109055849 13:57547434-57547456 CTGAAAGGATGGAATAATGAAGG + Intergenic
1109552870 13:63927979-63928001 CAAAAAGCCTAGAATTGTGGAGG + Intergenic
1109774389 13:67021104-67021126 CTGAATGGCAAGAAATGTAAAGG - Intronic
1111141841 13:84128968-84128990 CAGAAAGGCTAGAATAGTGTAGG - Intergenic
1111746364 13:92274645-92274667 CTGAAAAGCTAAAATGGGGAAGG + Intronic
1115918698 14:38346503-38346525 CTTAAAGGTTAGAATTAAGATGG + Intergenic
1119029252 14:71178790-71178812 CTGAATGGCTAAAATTGAAAAGG - Intergenic
1120981723 14:90295694-90295716 CTGAAAGGTTAGCGTTGAGAGGG - Intronic
1202869993 14_GL000225v1_random:153740-153762 CTCAAAGGCCAGAAATGTCAAGG + Intergenic
1126316848 15:47379008-47379030 CAGAAAGGGTAGAATTATGTTGG + Intronic
1129824480 15:78625540-78625562 CAGAAAAGCTAGGAATGTGAGGG + Intronic
1131923098 15:97351703-97351725 CTCAAAGGCCAAACTTGTGACGG + Intergenic
1135787869 16:25366633-25366655 CTGAAAGTCTAGATTTGTAAGGG + Intergenic
1137924276 16:52525014-52525036 CTGAAAGGCAAGATATTTGAGGG + Intronic
1140152837 16:72389365-72389387 CTTAAAGGCTAGAATTGGGTAGG - Intergenic
1144229518 17:13187091-13187113 CTGAAAGGTTGGAAATGTGGAGG + Intergenic
1144365793 17:14542841-14542863 CTTAAAGGCTAGAAGTATGAGGG + Intergenic
1145240017 17:21235716-21235738 GTGAATGGCTAGAACAGTGAGGG - Intergenic
1149172421 17:53826024-53826046 ATGAGAGCCTAGAATTGAGAGGG + Intergenic
1154949663 18:21196815-21196837 CTGGAAGCATAGGATTGTGATGG - Intergenic
1157646923 18:49283794-49283816 CTGAGAGGCAAGGATTGTGTTGG - Intronic
1158149031 18:54345684-54345706 CTAAAAGGCTATAGTAGTGAAGG + Intronic
1159666841 18:71171674-71171696 CTGAAGGGGTAGTATTGGGAGGG - Intergenic
1159703856 18:71662723-71662745 ATGAAACACTAGAATTGTGTTGG - Intergenic
1160409326 18:78664431-78664453 CTGAAACTCTAGAATTTTGGGGG - Intergenic
1161828099 19:6583032-6583054 CTGCAGGGCTAGATTTGTGAGGG + Intergenic
1167928213 19:52840676-52840698 CTTACAGGGTTGAATTGTGATGG + Exonic
925716284 2:6786982-6787004 CTGTAAGGCTAGAAGCGAGAGGG - Intergenic
926686705 2:15703856-15703878 CTGAAAGACTTGACTTGTAAAGG + Intronic
929379366 2:41332438-41332460 CTGAGAGACTAGAAGTGTGAAGG - Intergenic
932514438 2:72330543-72330565 CTGAAAGTCAAGCATTGTTAAGG - Intronic
932809496 2:74812395-74812417 CTGACTGTCGAGAATTGTGAAGG + Intergenic
932974429 2:76580341-76580363 TTGGAAAGCTAGAAATGTGAAGG - Intergenic
933538128 2:83603034-83603056 CTGCGGGACTAGAATTGTGAAGG - Intergenic
934183662 2:89651379-89651401 CTCAAAGGCCAGAAATGTCAAGG - Intergenic
934293949 2:91725550-91725572 CTCAAAGGCCAGAAATGTCAAGG - Intergenic
936749532 2:115624516-115624538 CTAACAGTCTAGAATTGTGATGG - Intronic
936751460 2:115647267-115647289 CTGAAATTCTAGAATTCAGAAGG - Intronic
938731397 2:134150633-134150655 CTGAAAGGCTCAAATTATGGAGG - Intronic
939166662 2:138648110-138648132 CGGTGAGGCTGGAATTGTGATGG - Intergenic
944674524 2:202023971-202023993 GTGAAAGGCTAGAAAAGCGATGG + Intergenic
948229765 2:236341471-236341493 CTGAAATTCTAGAGGTGTGAGGG + Intronic
948761365 2:240193694-240193716 CTGAATGGCTAGAATTTGAAAGG - Intergenic
1170360866 20:15544835-15544857 CTGAAGGGCTAGAAGTCAGAGGG - Intronic
1173411687 20:42816856-42816878 ATGAAAGGCAAGAATCGTTATGG + Intronic
1174445507 20:50588152-50588174 CTGAAAGGCTAGAATTGAAAAGG + Intronic
1177146669 21:17413982-17414004 CTGGAAGGCCAGAAGTTTGATGG + Intergenic
1178971582 21:37182692-37182714 CTGAAAGGCTAGAATTGTGACGG - Intronic
1179594983 21:42437434-42437456 ATCAGAGGCTAGAATTATGAAGG + Intronic
1180092226 21:45539014-45539036 CTGAAAGGCACGATTTGTGGTGG - Intronic
951541335 3:23784737-23784759 TTGAAATGCTAGCATTCTGAGGG - Intergenic
953358332 3:42273194-42273216 CTCAAATGCAAGAATTGTGCTGG + Intergenic
960176630 3:114525051-114525073 GTGACAGGCTAGAGTAGTGATGG - Intronic
961062361 3:123841629-123841651 AAGAAAGGCTAGAAATATGATGG - Intronic
965072035 3:163926288-163926310 CTGAAAAGGAAGAATTGTGTGGG - Intergenic
971809995 4:31412553-31412575 CTGAGGGCCTAGAATTGTGCTGG + Intergenic
972870528 4:43292343-43292365 ATGAAAAACTAGAATTGTTATGG - Intergenic
974265223 4:59578715-59578737 CTGAAAGCCTAAAATAGTGGTGG - Intergenic
974663851 4:64932146-64932168 CTGAATTGCTAGAAATGTTAAGG - Intergenic
974891905 4:67893363-67893385 TTGAAATGCTAGGATTGTTATGG + Intergenic
976336339 4:83892308-83892330 CTTAAAGGATTGAAGTGTGAAGG - Intergenic
976817187 4:89162609-89162631 CTGAAGGGCTGAAATTGTCAAGG + Intergenic
978143370 4:105343056-105343078 TTAGAAGGCTAGCATTGTGATGG - Intergenic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
980829132 4:138108501-138108523 CCGTAAGGCTAGCATTATGAAGG + Intergenic
981641804 4:146952582-146952604 CTGAAAAGCCAGACTTGAGAAGG - Intergenic
982260980 4:153494012-153494034 CTGAGAAGCTAGAATTGTTGTGG + Intronic
989059695 5:37398026-37398048 CTGAAAGGAAAGAATGCTGAAGG + Intronic
989182221 5:38589857-38589879 TGGAAATGCTAGAATTGTGAGGG + Intronic
996915738 5:128710306-128710328 CGGAGTGGCTAGAATTGTGGAGG - Intronic
997210001 5:132071679-132071701 CTGAAAGGCTAGAAGTCAGGTGG - Intergenic
998412376 5:141921358-141921380 CTGAAAGGAGAGAACTGGGAAGG + Intergenic
998451049 5:142235163-142235185 CTCACAGGCTGGAAGTGTGATGG - Intergenic
998984609 5:147742308-147742330 CTGGAAGGCAAGCATTGAGAGGG - Intronic
1004921624 6:20381426-20381448 CTGAAAGGCTAGGATTTTTAAGG + Intergenic
1005389957 6:25322980-25323002 GAGGAGGGCTAGAATTGTGATGG + Intronic
1007177309 6:39905765-39905787 CTGAAAGGCTGCAAGTCTGATGG + Exonic
1008664901 6:53706547-53706569 CTCAAGGGCTAGGATTGTAAAGG - Intergenic
1008837951 6:55860524-55860546 TTGTAATGCTAGAAGTGTGAAGG - Intronic
1009923095 6:70087473-70087495 CGGTATGGCTAGAATGGTGAAGG + Intronic
1015764024 6:136696573-136696595 CTGAAAGGCTAGGAATGGAAAGG + Intronic
1020121543 7:5506802-5506824 CTGAAAGGCTAGCGTTGTGGAGG - Intronic
1021421866 7:20454400-20454422 CTTAAAGTCTAAAATTTTGATGG + Intergenic
1021587303 7:22222955-22222977 CTGAAAGGATGGAGTTGTCATGG + Intronic
1021614600 7:22488813-22488835 CTCAAAGGCTAGAAAACTGAGGG - Intronic
1022781548 7:33589635-33589657 CTGAAAGGGTGGAGTTGAGATGG + Intronic
1024394687 7:48852360-48852382 CTTGAAGGCTAGAAGTGCGATGG - Intergenic
1024400572 7:48920281-48920303 CTTGAAGGCTAGAAGTGCGATGG + Intergenic
1027398070 7:77777172-77777194 CACAAAGGCCAGAAATGTGAGGG - Intronic
1028150526 7:87366333-87366355 CAAAAAGGCTAAAATTGTTAAGG - Intronic
1028763237 7:94519346-94519368 AAGAAAGTTTAGAATTGTGAGGG + Intronic
1034178563 7:149120085-149120107 TTGAAATGGCAGAATTGTGATGG - Intronic
1037297552 8:17417108-17417130 TTGAAAGGATAGAAGTGGGAAGG - Intergenic
1038862603 8:31403663-31403685 ATGAAAGGCTAGAAGAATGAGGG - Intergenic
1039128470 8:34231749-34231771 CTGACAGGCTAGAAATTTCAGGG - Intergenic
1040688323 8:49904067-49904089 CTAAAAAGTTAGAATTGTGAAGG + Intergenic
1041703484 8:60818345-60818367 CTTAAAGGGTAGAAATGTGTAGG + Intronic
1043448564 8:80343015-80343037 CTGGAAGGATAGCATTGAGATGG - Intergenic
1046307997 8:112396190-112396212 CTGAAATGATACAATTGAGAGGG + Intronic
1046564186 8:115877751-115877773 CTGAAAGTCTATAATTAGGATGG + Intergenic
1053369556 9:37549205-37549227 CTGAAAGGTTATTATTGGGAGGG - Intronic
1054978908 9:71180866-71180888 CTAATAGGCTAGAATTTTGAGGG - Intronic
1055241630 9:74193222-74193244 ATGAAAGGCAAGAGTTTTGATGG - Intergenic
1056131168 9:83588078-83588100 CTGAAAGGCTAGGGTGGGGATGG - Intergenic
1057710977 9:97444015-97444037 GAGAAATTCTAGAATTGTGAAGG - Intronic
1059315607 9:113423246-113423268 TTGAGAGGCTAGAATGTTGATGG + Intronic
1059848182 9:118304643-118304665 CAGAAGGGCTAGATTTTTGATGG - Intergenic
1062519228 9:136950745-136950767 CTGAAACGCTAGCGTTGTGCTGG + Intronic
1203734462 Un_GL000216v2:122803-122825 CTCAAAGGCCAGAAATGTCAAGG - Intergenic
1185664136 X:1751044-1751066 CTGAAATGCTAGATTTGTTTTGG + Intergenic
1187319667 X:18228145-18228167 CTGAAAGGGTAGGATGGTGCAGG - Intergenic
1187392248 X:18893781-18893803 CTGAGAGGCTCCAATTCTGAGGG + Intronic
1187730575 X:22249630-22249652 CTGAATGGATAAACTTGTGAAGG + Exonic
1188372834 X:29389614-29389636 CTGGAATACTAGAATTGAGAAGG - Intronic
1188712435 X:33416679-33416701 CTGCAAGGCCAGGATAGTGAAGG - Intergenic
1189181948 X:39012765-39012787 CTGAAAGACTAGGGCTGTGATGG + Intergenic
1189735901 X:44069249-44069271 CTGAAAGTCCAGATTTCTGAAGG + Intergenic
1194908661 X:99611039-99611061 CTGAAAGGCAAGCACTTTGAGGG - Intergenic
1195862911 X:109400258-109400280 CTGGAAGGCTACAATGGAGAAGG + Intronic
1196987562 X:121291630-121291652 CTCAAAGGATAGAACTGTGTAGG + Intergenic
1198707498 X:139464387-139464409 CTGCAAGGCTAGCATTATGCAGG - Intergenic
1198810413 X:140530539-140530561 ATTAAAACCTAGAATTGTGAGGG - Intergenic
1199408786 X:147494781-147494803 GTGAAGGGCTAGTATTGTGCTGG - Intergenic
1202626573 Y:56865796-56865818 CTCAAAGGCCAGAAATGTCAAGG + Intergenic