ID: 1178977219

View in Genome Browser
Species Human (GRCh38)
Location 21:37230669-37230691
Sequence ACAGAAACACTTCACTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 223}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178977219_1178977231 21 Left 1178977219 21:37230669-37230691 CCACCCCAGTGAAGTGTTTCTGT 0: 1
1: 0
2: 2
3: 24
4: 223
Right 1178977231 21:37230713-37230735 ATCCGGCTCCCGGGAGTTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 36
1178977219_1178977227 11 Left 1178977219 21:37230669-37230691 CCACCCCAGTGAAGTGTTTCTGT 0: 1
1: 0
2: 2
3: 24
4: 223
Right 1178977227 21:37230703-37230725 TGGACAGACAATCCGGCTCCCGG 0: 1
1: 0
2: 0
3: 6
4: 46
1178977219_1178977224 -9 Left 1178977219 21:37230669-37230691 CCACCCCAGTGAAGTGTTTCTGT 0: 1
1: 0
2: 2
3: 24
4: 223
Right 1178977224 21:37230683-37230705 TGTTTCTGTCCGGCAGAAAGTGG 0: 1
1: 0
2: 0
3: 6
4: 127
1178977219_1178977229 19 Left 1178977219 21:37230669-37230691 CCACCCCAGTGAAGTGTTTCTGT 0: 1
1: 0
2: 2
3: 24
4: 223
Right 1178977229 21:37230711-37230733 CAATCCGGCTCCCGGGAGTTCGG 0: 1
1: 0
2: 0
3: 2
4: 34
1178977219_1178977228 12 Left 1178977219 21:37230669-37230691 CCACCCCAGTGAAGTGTTTCTGT 0: 1
1: 0
2: 2
3: 24
4: 223
Right 1178977228 21:37230704-37230726 GGACAGACAATCCGGCTCCCGGG 0: 1
1: 0
2: 0
3: 8
4: 94
1178977219_1178977230 20 Left 1178977219 21:37230669-37230691 CCACCCCAGTGAAGTGTTTCTGT 0: 1
1: 0
2: 2
3: 24
4: 223
Right 1178977230 21:37230712-37230734 AATCCGGCTCCCGGGAGTTCGGG 0: 1
1: 0
2: 0
3: 3
4: 36
1178977219_1178977226 4 Left 1178977219 21:37230669-37230691 CCACCCCAGTGAAGTGTTTCTGT 0: 1
1: 0
2: 2
3: 24
4: 223
Right 1178977226 21:37230696-37230718 CAGAAAGTGGACAGACAATCCGG 0: 1
1: 0
2: 1
3: 13
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178977219 Original CRISPR ACAGAAACACTTCACTGGGG TGG (reversed) Intronic
900711032 1:4114220-4114242 AAAAAAAAACTTCACTGGGCAGG - Intergenic
900804450 1:4758128-4758150 ACAGTTACACATCACTGGGGAGG - Intronic
902716976 1:18279728-18279750 ACAGACAGGCTTCACTGGGCTGG + Intronic
902862119 1:19253943-19253965 GCAGCAACACCTCTCTGGGGAGG - Intronic
903003235 1:20281467-20281489 ACACAAACCCATAACTGGGGAGG + Intergenic
905199930 1:36308361-36308383 AAAGAAACACGCCAGTGGGGAGG - Intronic
911140327 1:94494348-94494370 AGAGAAACAGTTCCCAGGGGAGG - Intronic
911988115 1:104657483-104657505 CCAGAGACATTGCACTGGGGAGG - Intergenic
913069204 1:115284301-115284323 ACAGACACAGATCACTGGGAGGG + Intergenic
917492911 1:175513518-175513540 GCAGCAGCACTGCACTGGGGAGG - Intronic
919376577 1:196801758-196801780 ACAGAAACAGTTTACGGGGTTGG + Intergenic
919386277 1:196926669-196926691 ACAGAAACAGTTTACGGGGTTGG + Intronic
920225908 1:204438949-204438971 GCAGAAACACAACCCTGGGGAGG - Exonic
920895776 1:210048376-210048398 ACAGTTCCACATCACTGGGGAGG + Intronic
921901459 1:220455849-220455871 ATAGGAACACTTGACTGGGAAGG - Intergenic
923472078 1:234300664-234300686 TCAGGAACACTTCACTGAAGGGG + Intronic
923499806 1:234555274-234555296 GCAGAGACGATTCACTGGGGTGG - Intergenic
1063004563 10:1955990-1956012 GAACAAACACCTCACTGGGGAGG - Intergenic
1063342738 10:5283374-5283396 ACAGAAACACATCACAGAGGAGG - Intergenic
1065585280 10:27211612-27211634 ACAAAAACAACTCACTGGGCGGG - Intronic
1065615024 10:27512394-27512416 CCAGAATCACTTGAATGGGGAGG - Intronic
1070164440 10:73887340-73887362 ACAGAAACTCACCACTGGGCAGG - Intergenic
1070782301 10:79144705-79144727 ACGGAAACTATTCACTGGGAAGG - Intronic
1070920987 10:80186311-80186333 AGAGAAACACGGAACTGGGGAGG + Intronic
1073311646 10:102546967-102546989 ACAGCACCACTTCACTAAGGAGG - Intronic
1075002418 10:118808526-118808548 ACAGAACCACTTTCCTGGAGAGG + Intergenic
1075550500 10:123389272-123389294 ACAGTTACACTTGGCTGGGGAGG - Intergenic
1076026821 10:127122376-127122398 ACAGAACCAGGTCACTGAGGAGG - Intronic
1076760216 10:132600711-132600733 ACAGTTCCACATCACTGGGGAGG + Intronic
1080110202 11:28558116-28558138 CCAGAAAAATTTCACTGGAGGGG - Intergenic
1080402950 11:31954302-31954324 ACTGACACTCTTCACTGAGGAGG - Intronic
1080728774 11:34924939-34924961 ACAAAATAATTTCACTGGGGAGG - Intronic
1080896167 11:36450219-36450241 CCTGAAACACTGCACTGGAGTGG + Intronic
1083296099 11:61716446-61716468 CCAGAAACACATCACTGGAAGGG - Intronic
1084235040 11:67782295-67782317 ACAGATCCACATGACTGGGGAGG - Intergenic
1085320608 11:75571777-75571799 ACAGAAACACCTGGCTGGGCTGG + Exonic
1085762404 11:79253389-79253411 AAACAAACACTGCACTGGAGTGG + Intronic
1086032734 11:82379790-82379812 ACAGATCCACATGACTGGGGAGG + Intergenic
1090070126 11:123536775-123536797 ACCAAAACACATGACTGGGGAGG - Intronic
1091009122 11:131982289-131982311 AAAGAAACCCCACACTGGGGAGG - Intronic
1093303995 12:17489512-17489534 GTGGAAACACTTCTCTGGGGTGG + Intergenic
1093554805 12:20459082-20459104 AAAGAAACACTATACTGGGAAGG - Intronic
1095133565 12:38571541-38571563 CCAGAGACACTGGACTGGGGTGG + Intergenic
1095940928 12:47726253-47726275 ACAAAAGAACCTCACTGGGGAGG - Intergenic
1096767706 12:53907001-53907023 ACAGAAACAGTGGACTGTGGAGG + Intergenic
1097522912 12:60690393-60690415 ACAGTTCCACTTGACTGGGGAGG - Intergenic
1098328946 12:69332578-69332600 GCAGAAACAAATCACTGTGGTGG - Intergenic
1101176940 12:102162008-102162030 AAAGAAAAACTTCACTGGACAGG - Intronic
1102811690 12:115829726-115829748 ACAGTTCCACATCACTGGGGAGG - Intergenic
1104051961 12:125201111-125201133 AGAGAAACACTTAACTGGGCTGG - Intronic
1104083781 12:125456699-125456721 ACAGAGAGACTGCAGTGGGGAGG - Intronic
1105947396 13:25201699-25201721 ATAGGGACACTTGACTGGGGTGG + Intergenic
1107976478 13:45693309-45693331 ACAGAGGGACTTCAATGGGGTGG + Intergenic
1108929784 13:55804467-55804489 ACAGAATCGCTTGACTTGGGAGG - Intergenic
1110361406 13:74629733-74629755 ACAGTTCCACATCACTGGGGAGG - Intergenic
1111094933 13:83500848-83500870 ACAAAAAAACTTCACTTCGGTGG + Intergenic
1111637640 13:90926809-90926831 ACAGAAACTGGTTACTGGGGTGG - Intergenic
1113577842 13:111406779-111406801 AGAGAACCAATTCACTGTGGTGG + Intergenic
1114028464 14:18553020-18553042 ACAGAAAGACTTCAGATGGGAGG - Intergenic
1116145860 14:41068459-41068481 TCAGAAACACCTCACTGAGAAGG + Intergenic
1117326055 14:54669998-54670020 ACAAAAACATTTCACTGGTCTGG - Intronic
1118657610 14:67968943-67968965 ACAGTTCCACTTGACTGGGGAGG + Intronic
1119444997 14:74655655-74655677 ACAGAAATACCTGACTGGGAGGG + Intronic
1119498907 14:75106039-75106061 ACAGAACCTATTCACTGGGAAGG - Intronic
1120145808 14:80977112-80977134 AGAGACACACTTCACAGAGGAGG - Intronic
1121820736 14:96964064-96964086 ACAGAACCATTTCACTGTGTAGG - Intergenic
1122634295 14:103123024-103123046 ACCGGAACACTTCAGAGGGGCGG + Intergenic
1122809620 14:104281530-104281552 ACACAAACAGTTGAGTGGGGTGG + Intergenic
1124581084 15:30955631-30955653 ACAGAAACACTGCCAAGGGGGGG + Intronic
1125050016 15:35285527-35285549 ACAGTTACACATAACTGGGGAGG - Intronic
1126281705 15:46959326-46959348 ACATAAATATTTCTCTGGGGGGG - Intergenic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1128929526 15:71691706-71691728 AGAGAAACACTTCCCAGGGGAGG - Intronic
1129979842 15:79858361-79858383 ACAGGAAAACCTCACTAGGGAGG + Intronic
1131228318 15:90643043-90643065 ACAGAGACACAGCTCTGGGGAGG - Intronic
1131864953 15:96698155-96698177 ACAGAATCAGTTCCTTGGGGGGG + Intergenic
1133838301 16:9385981-9386003 ACAGTTCCACGTCACTGGGGAGG + Intergenic
1134474051 16:14555953-14555975 GAAGAACCACTTAACTGGGGAGG - Intronic
1135691463 16:24540410-24540432 TCAGAATCACTTCATGGGGGAGG - Exonic
1136132224 16:28230375-28230397 ACAAAAACACTTCAGTTGGCCGG - Intergenic
1138066951 16:53952111-53952133 ACAAAACTACTTCACTGGGTTGG - Intronic
1138084714 16:54122977-54122999 AAAGCAACACTTAATTGGGGAGG + Intergenic
1139212345 16:65091966-65091988 CCAGAGAGACTTCTCTGGGGAGG - Intronic
1140401142 16:74672726-74672748 ACACAAACACCTCACAGGAGGGG + Intronic
1140902564 16:79383205-79383227 ACTGAAACCCTGGACTGGGGTGG + Intergenic
1141289018 16:82700400-82700422 ACGGTAACTCTTCACTGGTGGGG - Intronic
1141609941 16:85175570-85175592 CCAGCAGCACTTCACGGGGGCGG - Intronic
1142686567 17:1580504-1580526 GAAGAAACACTTCACGAGGGAGG - Intronic
1142757037 17:2022735-2022757 AGAGAAGCCCTTCACTGGGCTGG - Intronic
1144565368 17:16354784-16354806 ATAGCAACAATTCGCTGGGGCGG - Intergenic
1150455636 17:65304590-65304612 CCAGAAAGCCTTCTCTGGGGGGG - Intergenic
1150950366 17:69797378-69797400 ACAGAAAAACTTCAATAAGGAGG + Intergenic
1151918336 17:77135345-77135367 ACAGAAACAGTTGACTAGGCAGG - Intronic
1153674589 18:7445543-7445565 ACAGGAACAGTTCTCTGAGGAGG + Intergenic
1155522453 18:26682753-26682775 ACGGAAAGGCTTCACTGGGTAGG - Intergenic
1155779395 18:29811837-29811859 GCAAAAGCACTTCATTGGGGTGG - Intergenic
1157699214 18:49749862-49749884 AAAGAGACATTTCACTGGAGAGG - Intergenic
1157884001 18:51348824-51348846 AAAGGAAGACATCACTGGGGAGG - Intergenic
1158078229 18:53556911-53556933 ATAGAAAAACTTCACTGCTGAGG + Intergenic
1159439192 18:68455805-68455827 ACAGTTACACTTGGCTGGGGAGG - Intergenic
1159636020 18:70805947-70805969 ACAGTTCCACTTGACTGGGGAGG - Intergenic
1161188270 19:2937724-2937746 ACACAAACCCTTCTCTGAGGAGG - Intronic
1161204718 19:3035023-3035045 ACAGGCACACTGCACCGGGGAGG + Intronic
1162670293 19:12251462-12251484 AAATGAACACTTCTCTGGGGTGG - Intronic
1165444685 19:35850374-35850396 GCAGAAACTCTTCACTGTGGAGG - Exonic
1166160969 19:40952946-40952968 ACAGTTACACATGACTGGGGAGG + Intergenic
926198098 2:10775613-10775635 TCAGAAACCCTTCACGGAGGAGG + Intronic
927338150 2:21949253-21949275 ACAGACACATTTCACTGCAGAGG - Intergenic
927995799 2:27484944-27484966 AGAGAAATGCCTCACTGGGGAGG - Intronic
930160373 2:48149300-48149322 TCAGAAACACCTCATTTGGGTGG + Intergenic
932018507 2:68058545-68058567 ACAGAAACAGGTCACAGGGCTGG + Intronic
932673899 2:73761404-73761426 ACACAGACCCTTCATTGGGGAGG - Intergenic
935204261 2:100883914-100883936 ACAGAAACACTTCTCTGTGTGGG - Intronic
935425902 2:102918055-102918077 ACAGTTCCACTTGACTGGGGAGG + Intergenic
935492013 2:103733315-103733337 AGTGAAGCACTTCACTGGAGTGG + Intergenic
939606080 2:144255889-144255911 ACAAACACACACCACTGGGGTGG + Intronic
940236280 2:151514020-151514042 ACGAAAACACTACACTGGAGTGG - Intronic
940393010 2:153154358-153154380 ACAGTTCCACATCACTGGGGAGG - Intergenic
940800763 2:158130184-158130206 ACAAAAACACTGCATTTGGGAGG + Intronic
941193526 2:162417584-162417606 ACAGAAACATTACACTGAGGTGG - Intronic
943502334 2:188707393-188707415 ACAGTTCCACATCACTGGGGAGG - Intergenic
944697392 2:202214810-202214832 TCAGTGACACTTCACTTGGGGGG - Intronic
945090075 2:206170026-206170048 ACAGTTCCACTTGACTGGGGAGG - Intergenic
945504877 2:210627733-210627755 ACAGAAATACTACACAGGAGAGG + Intronic
948229115 2:236336775-236336797 ACCGTAACACTGCACTGGCGGGG - Intronic
949073833 2:242042411-242042433 ACAGTTCCACTTGACTGGGGAGG - Intergenic
1168949314 20:1785799-1785821 ACAGGAAGCCTTCTCTGGGGAGG + Intergenic
1169929630 20:10818497-10818519 ACAGTTCCACTTGACTGGGGAGG + Intergenic
1173430574 20:42983749-42983771 AAAGAAACACGACAGTGGGGTGG - Intronic
1174687743 20:52471878-52471900 ACAAACACACTTCAGTGGGGTGG - Intergenic
1178419281 21:32430561-32430583 ACAGATCCACGTGACTGGGGAGG + Intronic
1178977219 21:37230669-37230691 ACAGAAACACTTCACTGGGGTGG - Intronic
1179018815 21:37618779-37618801 ACAAAAATATTTCACTGGGGTGG - Exonic
1180108364 21:45634492-45634514 CCAGAAGCACTTCTCTGGTGTGG - Intergenic
1180452587 22:15480072-15480094 ACAGAAAGACTTCAGATGGGAGG - Intergenic
1182849650 22:33461367-33461389 ACTGAAACAATTCAATGGGAGGG - Intronic
951006805 3:17626627-17626649 GCAGAAAGACTTCACAGAGGGGG + Intronic
951038889 3:17966497-17966519 ACAGAGACCCTTCACTGTGGTGG - Intronic
954225486 3:49178190-49178212 AATGAAAGACATCACTGGGGAGG - Intronic
955123121 3:56081756-56081778 ATAGAAAAATATCACTGGGGTGG + Intronic
955298824 3:57757485-57757507 ACATCAACTCTTCACTTGGGTGG - Exonic
956489528 3:69755983-69756005 ACAGAAACATTTCTCTGTGCAGG + Intronic
956888596 3:73586602-73586624 ACAGGGACACTTCACCGGGGGGG + Intronic
956963343 3:74429827-74429849 ACACAAACAGTTCACTGAAGAGG + Intronic
958084316 3:88786921-88786943 ACAGTACCACATGACTGGGGAGG + Intergenic
960797788 3:121506333-121506355 ACATGGACAATTCACTGGGGAGG + Intronic
961145415 3:124588973-124588995 ACTGAATCACTTCACTGGGGAGG + Intronic
961884682 3:130088824-130088846 ACAGAGCCACATGACTGGGGAGG - Intronic
962354464 3:134681710-134681732 ACAGAAACACTTCCAAGAGGAGG + Intronic
963391272 3:144666508-144666530 ACAGTACCACATGACTGGGGAGG + Intergenic
963398540 3:144765754-144765776 ACAGAACCCCTTCACTGGAAGGG - Intergenic
964572749 3:158128162-158128184 ACAGAAACCCATCCCTTGGGTGG + Intronic
966781924 3:183591488-183591510 CCATCAACAGTTCACTGGGGAGG - Intergenic
967164872 3:186771791-186771813 AAACAAACATTTCACTGAGGAGG - Intergenic
968116226 3:196092138-196092160 ATAGAAATTCTTCCCTGGGGAGG - Intergenic
969062655 4:4450409-4450431 CCAGAATCACTTGACTCGGGAGG - Intronic
971148029 4:24000599-24000621 ACAGAAATAAATCACTGTGGGGG + Intergenic
972015871 4:34244804-34244826 ACAGAAAGGCTTCTCTGGGGAGG - Intergenic
973205656 4:47557665-47557687 TCAGACACCCTTCACTGGGGGGG + Exonic
973815463 4:54615085-54615107 ACAGAGACACTTCACAGTGGCGG + Intergenic
974469326 4:62297854-62297876 ACAGATTCACATCACTGGGGAGG + Intergenic
975385534 4:73755217-73755239 ACAGATACATTTCAATGGGGAGG + Intergenic
979025130 4:115561583-115561605 ACAGAAACACTGCACAATGGAGG + Intergenic
979526084 4:121718565-121718587 AAAAATACACTTCCCTGGGGTGG + Intergenic
983306045 4:165988485-165988507 ACAGACACACTCCACTGCGCTGG - Intronic
984459939 4:180021399-180021421 ACAGAAAAACTTCAGTGATGTGG + Intergenic
986069521 5:4268571-4268593 ACAGTCACACATGACTGGGGAGG + Intergenic
987617716 5:20298108-20298130 ACGCAAACACTTCAATGGAGAGG - Intronic
991374609 5:65953686-65953708 AAAGAAAAAATTCACTTGGGTGG - Intronic
993429499 5:87814330-87814352 GCAGAAGCACTTCATTGGGGTGG - Intergenic
994234109 5:97341865-97341887 ACAGTTCCACTTCTCTGGGGAGG + Intergenic
994911764 5:105918860-105918882 ACAGTACCACATCGCTGGGGAGG + Intergenic
996236746 5:121140583-121140605 ACAGTTTCACGTCACTGGGGAGG + Intergenic
996995756 5:129695257-129695279 TCAGAAACACTACACTGGCCTGG - Intronic
1001886355 5:175293870-175293892 ACAAAATCACTTCACTGGGGTGG - Intergenic
1002642538 5:180637057-180637079 ACAGAAACACCCCACTGGCTGGG + Intronic
1003333497 6:5149285-5149307 ACAGAAAGACCTCACAGGAGAGG + Intronic
1003576892 6:7305564-7305586 ACAGAATCAAATCACTGAGGAGG + Intronic
1003781124 6:9428273-9428295 ACTGAAACACATAACTGGGTAGG + Intergenic
1004584380 6:16985308-16985330 ACCAAAACACTGAACTGGGGAGG + Intergenic
1004629985 6:17411960-17411982 ATAGAAACCCTTCACTGAAGAGG - Intronic
1005280728 6:24270874-24270896 CCAGAAACTCACCACTGGGGCGG + Intronic
1006474925 6:34247498-34247520 ACAGAGACACAGCACTGTGGGGG + Intronic
1008145516 6:47886989-47887011 CCAGAAACTCTTCACTGGCCAGG + Intronic
1009909916 6:69913372-69913394 ACAGAAATAATTCAATGGAGGGG - Intronic
1011041317 6:83032917-83032939 ACAGTATCACATGACTGGGGAGG - Intronic
1011798338 6:90982355-90982377 TCAGAAACACTTTATTGGGTTGG + Intergenic
1012811785 6:103967939-103967961 ACAGTTACACATGACTGGGGAGG + Intergenic
1013370394 6:109465485-109465507 ACAAAAAAACATAACTGGGGAGG + Exonic
1013854996 6:114561640-114561662 ACATAAACAATTTAATGGGGAGG - Intergenic
1014809325 6:125867910-125867932 ACCGAAACACCGCACTGGTGAGG - Intronic
1015161691 6:130159323-130159345 ACAGTTACACATGACTGGGGAGG - Intronic
1016340671 6:143059150-143059172 ACAGAAACAGAACACTGGAGAGG + Intergenic
1017331141 6:153199270-153199292 ACAGAAGCAGTTCACTGCAGTGG - Intergenic
1019041324 6:169108447-169108469 ACAGTTCCACGTCACTGGGGAGG - Intergenic
1019526985 7:1484916-1484938 ACAGAGACCCTGCCCTGGGGAGG - Intronic
1021077499 7:16322858-16322880 ACAGTTCCACATCACTGGGGAGG + Intronic
1023013895 7:35947147-35947169 GCAGAAATTCTTCACTGGCGAGG - Intergenic
1023550189 7:41361911-41361933 ACAGTAACACTTATCTGGGATGG + Intergenic
1023816537 7:43954775-43954797 ACAGAAACACTTCACTCATGTGG + Exonic
1024067093 7:45747837-45747859 GCAGAAATTCTTCACTGGCGAGG + Intergenic
1025990508 7:66493416-66493438 ACAGAAACACTGTGCTGGGTCGG + Intergenic
1026117366 7:67507233-67507255 ACACAAACAATTCAATGGGATGG + Intergenic
1026504160 7:70968078-70968100 TCAAAAACAAATCACTGGGGTGG + Intergenic
1026658574 7:72278630-72278652 CCAGAAACACCTCCCTGGGAGGG + Intronic
1026868629 7:73837515-73837537 ACAGAAAGACTGCCCTGGGAAGG - Intronic
1027213170 7:76166429-76166451 ACAGAAACACTGTGCTGGGTCGG + Intergenic
1027665039 7:81034630-81034652 ACTGTAACACTTCACTGCGAGGG + Intergenic
1027692281 7:81363028-81363050 ACAGAAACAGTGCAATTGGGGGG + Intergenic
1030624754 7:111832251-111832273 ACAGGAAAACTTCCCAGGGGAGG - Intronic
1031297152 7:120015076-120015098 ACAGAAAAACTGCAGTGGGCAGG + Intergenic
1037113536 8:15195628-15195650 ATAGAAGTATTTCACTGGGGTGG - Intronic
1037414236 8:18631771-18631793 AGAGAAACATTGCAGTGGGGTGG - Intronic
1037800825 8:22034319-22034341 ACAGAAGCACTTAAGAGGGGTGG + Intronic
1038151654 8:24946554-24946576 AAAGAAACACTTCACTAGAAGGG + Intergenic
1038269872 8:26066423-26066445 ACAGATCCACATGACTGGGGAGG - Intergenic
1038753495 8:30318449-30318471 ACAGAAACACAGCACTTGGGAGG + Intergenic
1039094534 8:33869305-33869327 CAAGAGACACTTCACTGGGATGG + Intergenic
1039404523 8:37301187-37301209 ACAGAAACAGATCACTGGAATGG + Intergenic
1041030043 8:53727598-53727620 ACAGGAGCTCTTCACTGGGGAGG - Intronic
1045403130 8:101838514-101838536 ATGGAAACACTTAACTGGGCTGG - Intronic
1046257498 8:111720823-111720845 ACAGTTACACATAACTGGGGAGG + Intergenic
1050950102 9:11579521-11579543 AGAGAAAAACTTCACAGAGGAGG - Intergenic
1051192218 9:14525442-14525464 CCAGAACCACTTTACAGGGGAGG - Intergenic
1051332789 9:16040299-16040321 GCAGAATCCCTTCACTGGGGAGG - Intronic
1057198310 9:93127213-93127235 GCAGCAAGACTTCACTGAGGTGG + Intronic
1057210326 9:93197815-93197837 ACAGAAACACCACACAGGGCCGG - Intronic
1058147118 9:101424591-101424613 ACAGAAACACTTCAGAGGGAAGG - Intronic
1058201412 9:102046424-102046446 ACAAAAGCACTTGAGTGGGGTGG + Intergenic
1058916258 9:109568714-109568736 GCAAAAGCACTTCACTGGGCTGG - Intergenic
1059822248 9:117986133-117986155 ACAGTTCCACATCACTGGGGAGG - Intergenic
1062327261 9:136018226-136018248 ACAGAAAAACTCTACAGGGGTGG + Intronic
1062706950 9:137950970-137950992 ATGGGAACACTCCACTGGGGAGG + Intronic
1185803742 X:3037814-3037836 ACAGTTCCACATCACTGGGGAGG + Intergenic
1186360613 X:8837256-8837278 ACAGAAATACTTCAGTGTGTGGG - Intergenic
1187734272 X:22288692-22288714 ACAGTTACACATCACTGGGGAGG - Intergenic
1188110850 X:26194653-26194675 TCAGAATTCCTTCACTGGGGAGG - Exonic
1188604920 X:32016345-32016367 TGAGAAAGACTTCACTCGGGTGG - Intronic
1190907980 X:54746914-54746936 ACTGAAACAGTGGACTGGGGAGG - Intergenic
1194830891 X:98620979-98621001 ACAGGTACACATGACTGGGGAGG + Intergenic
1194893903 X:99415528-99415550 GCAAAAACACTTCATTGAGGAGG + Intergenic
1195338565 X:103880919-103880941 ACAGAATCATTTCTCTGGTGTGG + Intergenic
1195942815 X:110179482-110179504 AGAGAAACACTTCACTCCAGCGG + Intronic
1198410972 X:136367512-136367534 ACAAAAACACTGCACTGGGTTGG + Intronic
1199058654 X:143327968-143327990 CCAGAAACACTGGACTGGAGGGG + Intergenic
1199753404 X:150842622-150842644 ACAAAAACACTTAACTGGAATGG - Intronic
1201276979 Y:12308100-12308122 ACAGTTCCACATCACTGGGGAGG - Intergenic
1201344733 Y:12969830-12969852 AGAGAATCACTTGAATGGGGAGG - Intergenic
1201737625 Y:17286349-17286371 ACAGTTCCACTTGACTGGGGAGG - Intergenic
1202605272 Y:26634333-26634355 ATAGAAACACTTCATCAGGGAGG + Intergenic