ID: 1178977381

View in Genome Browser
Species Human (GRCh38)
Location 21:37231569-37231591
Sequence GGATCAAGTGAAGGACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178977381_1178977386 17 Left 1178977381 21:37231569-37231591 CCAGCTTGTCCTTCACTTGATCC 0: 1
1: 0
2: 0
3: 18
4: 189
Right 1178977386 21:37231609-37231631 ACAGCAGAATAAAGAATTAGAGG 0: 1
1: 0
2: 7
3: 43
4: 469
1178977381_1178977387 21 Left 1178977381 21:37231569-37231591 CCAGCTTGTCCTTCACTTGATCC 0: 1
1: 0
2: 0
3: 18
4: 189
Right 1178977387 21:37231613-37231635 CAGAATAAAGAATTAGAGGAAGG 0: 1
1: 0
2: 4
3: 55
4: 715

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178977381 Original CRISPR GGATCAAGTGAAGGACAAGC TGG (reversed) Intronic
901389950 1:8938484-8938506 GGGTCAAGTGAAGGACATTTAGG - Intergenic
901430256 1:9209748-9209770 CGAGCAAGTGAAGGAGAAGGGGG - Intergenic
902200761 1:14831775-14831797 GGAGGCAATGAAGGACAAGCAGG - Intronic
902356732 1:15907936-15907958 GAGTCAACTGAAGGACAAGAAGG - Intronic
903341634 1:22658609-22658631 GGATTCAGTGAAGAACAAGACGG - Intronic
907338328 1:53715412-53715434 GAGTCATGTGGAGGACAAGCAGG + Intronic
908390349 1:63678228-63678250 GGATCATGTGGAGGGCATGCTGG + Intergenic
913183786 1:116347787-116347809 GGATTAAGTACAGGACAAGCTGG + Intergenic
915770479 1:158417118-158417140 GGATCAATTGAAGGAGTAGGAGG + Intergenic
915926325 1:160022657-160022679 GTAACAAGTGAAGGAGAAGAAGG + Intergenic
917499625 1:175574398-175574420 GGATCAAATGAAAGAAAAGATGG + Intronic
918176588 1:182051738-182051760 AGATGAAGTCAAGGACAAGTGGG - Intergenic
918931577 1:190861822-190861844 GCAGAAAGTGAAGGAGAAGCAGG - Intergenic
919986185 1:202677044-202677066 GCAGAAAGTGAAGGAGAAGCAGG - Intronic
921707973 1:218345793-218345815 GGAGCAAGAGAAGGAGGAGCAGG + Intergenic
922044232 1:221928182-221928204 TGATCTAGTGAAACACAAGCTGG + Intergenic
923395574 1:233559033-233559055 GTATCAAGGGCAGGACCAGCTGG + Intergenic
924024270 1:239816559-239816581 GGACCAGGAGAAGGGCAAGCAGG - Intronic
924780756 1:247145231-247145253 GGATCAGGAGAAGGAAAAGATGG + Intronic
1065768245 10:29052343-29052365 GGATCGAGGGGATGACAAGCAGG + Intergenic
1070629192 10:78072420-78072442 GGACCAGGGGAAGGAGAAGCTGG + Intergenic
1071285117 10:84137341-84137363 GGATAGAGAAAAGGACAAGCCGG - Intergenic
1072518590 10:96210619-96210641 GGAGGAAGTGAAAGAGAAGCAGG + Intronic
1072546063 10:96440248-96440270 GAATAAAGTGGAGAACAAGCTGG - Intronic
1073964380 10:108971979-108972001 GGATAAAGAGAAAGAGAAGCAGG + Intergenic
1075011711 10:118876057-118876079 GGATAAAGACAAGGACAAACTGG + Intergenic
1075059159 10:119242629-119242651 GTATCAAGGGAGGGACAAGTTGG + Intronic
1078143081 11:8705651-8705673 GGAGCTCGTGAAGGAGAAGCAGG - Intronic
1078375656 11:10791221-10791243 GGAGAAAGTGAAGGGCAAGTAGG - Intergenic
1079956961 11:26878178-26878200 GGAGCAAGAGAAGGAAAAGGGGG + Intergenic
1080051303 11:27861652-27861674 GTATCAAGTGAAAGTCAATCAGG + Intergenic
1081348841 11:42024080-42024102 GGTACATGTGAAGGACATGCAGG + Intergenic
1081807309 11:45897565-45897587 GGAACAAGCGAAGGAAAATCTGG - Intronic
1083804634 11:65066589-65066611 GGATGAAGTGAAGGCCCTGCAGG - Intronic
1086105145 11:83139387-83139409 GCACCAAGAGAAGGACAACCTGG + Intergenic
1088298219 11:108324834-108324856 CAATCCAGTGAAGGAAAAGCTGG - Intronic
1089457133 11:118632236-118632258 GGATCAGCTGCAGGAGAAGCTGG + Exonic
1090470874 11:126979988-126980010 ATATCAAGTCAAGAACAAGCTGG + Intronic
1091227585 11:133966761-133966783 GTATCAGCTGAAGGACAGGCAGG + Intergenic
1092183382 12:6461437-6461459 GGAACAAGTGAGGGACAATGAGG + Intronic
1096231606 12:49900008-49900030 GGGAGAAGTGAAGGACAAGAGGG - Intronic
1101216955 12:102594889-102594911 GGAGCAAGTGAGAGAGAAGCTGG + Intergenic
1102244693 12:111347930-111347952 GGATGAAGTGAGGGACAGTCTGG - Exonic
1102467818 12:113140605-113140627 GGTTCAAGTGAAGGATAAGATGG + Intergenic
1102585193 12:113918098-113918120 GGAACAAGTGCAGGAGAAACAGG - Intronic
1106109237 13:26761890-26761912 GGAAGAAGGGAAGGAGAAGCGGG - Intergenic
1107652766 13:42561264-42561286 GGATAAAGTGAATGACAGGCTGG + Intergenic
1111173529 13:84561602-84561624 GGATAAATTGAAGGATAATCTGG - Intergenic
1112468750 13:99668908-99668930 GGCTCCAGGGCAGGACAAGCTGG + Intronic
1117746833 14:58878397-58878419 GGATCAAGTGAATTCCAAGGAGG + Intergenic
1118618790 14:67595791-67595813 GGACCAGGTGGAGGACAAGTAGG + Intronic
1119109549 14:71958714-71958736 GGATCAAGTGAAGGGAAGGCAGG + Intronic
1120916311 14:89713553-89713575 GGTACAAGTGCAGGACATGCAGG + Intergenic
1128620745 15:69147476-69147498 GGATCAAAGGAGGGACAAGATGG + Intergenic
1131892773 15:96991792-96991814 GGATAAAGTGAATAACATGCAGG - Intergenic
1133202796 16:4214705-4214727 GGATAAAGTCAAGGAAAAACAGG - Intronic
1133697181 16:8275908-8275930 GGCAGAAGTGAAGGAGAAGCAGG + Intergenic
1135480623 16:22817988-22818010 GGATCAGGCTAAGGACAAGAAGG - Intronic
1138700123 16:58853952-58853974 GGATCAACTGATGGCCAGGCTGG - Intergenic
1139548820 16:67662290-67662312 GGACCAAGTGACGGACATGATGG + Exonic
1140510097 16:75500984-75501006 GGATCAAGGGCAGGACCAGGTGG + Intergenic
1142561136 17:809631-809653 GGAGCAATGGAAGGAAAAGCAGG + Intronic
1144555544 17:16279632-16279654 GGAGCAAGAGAAGGACAATGGGG - Intronic
1150422491 17:65050926-65050948 GGCTCAAGTCAACAACAAGCAGG + Intronic
1151077728 17:71293509-71293531 GAAACAATTCAAGGACAAGCTGG - Intergenic
1152106454 17:78332233-78332255 GGATCGAGGGAAGGCCAAGGGGG - Intergenic
1152678018 17:81651500-81651522 GGAAGAAGTGATGGACAGGCTGG + Intronic
1153466533 18:5394595-5394617 GGATCAGGTGAAGGATGAGAGGG + Intronic
1156844058 18:41643181-41643203 TGAACAACTGAAGTACAAGCTGG - Intergenic
1157628778 18:49075519-49075541 GGATTCAGTGAAGGATAAACAGG + Intronic
1158451267 18:57567679-57567701 GGTTAAAGTGAAGGAAAAGACGG + Intronic
1161445984 19:4319426-4319448 GGATCCTGTGAAGAAGAAGCTGG + Intronic
1162549487 19:11350738-11350760 GGGTCAAGATTAGGACAAGCTGG + Intronic
1162770006 19:12943721-12943743 GAAACAAATGAAGGACAAACAGG + Exonic
1165105516 19:33467585-33467607 GGCTCAAATGTAGGACAAGAAGG + Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1167117717 19:47497861-47497883 GGAGGAAGTGGGGGACAAGCAGG + Intronic
926421014 2:12699394-12699416 GGATCAGGAGAAGGAGAAGGGGG + Intergenic
926649277 2:15324043-15324065 GGATCGAGTAAAGGGCAAGATGG + Intronic
927334841 2:21909432-21909454 GAATTAAGTGAAGGTCAAGGTGG + Intergenic
928244604 2:29616270-29616292 GGATTAAGGGAAGGACAGCCTGG + Intronic
930620070 2:53634553-53634575 AGCTCATGTGAAGGAGAAGCAGG - Intronic
931169612 2:59788951-59788973 GGATCAAGGGAAGAAAAAGTAGG + Intergenic
933185625 2:79275990-79276012 GGATAAAGTGAAGGTCAGGCAGG + Intronic
934580689 2:95435311-95435333 GGATCCTGTGAGAGACAAGCGGG - Intergenic
934598762 2:95641406-95641428 GGATCCTGTGAGAGACAAGCGGG + Intergenic
936503526 2:113085781-113085803 GGAGCCAGTGAAGGACAGGTTGG + Intergenic
936842618 2:116791096-116791118 AGGTCAAGTGAAGGAGAACCAGG + Intergenic
939017883 2:136922336-136922358 TGATCAAGGGAAGGATATGCAGG - Intronic
940368913 2:152878552-152878574 GCATCAAGTGAGGGAGAGGCAGG - Intergenic
942721869 2:178962304-178962326 GGATCAATTGAAGGAGCAGTTGG + Intronic
948060860 2:235042539-235042561 GGTTCAGGTGAAGGACGACCAGG + Exonic
948077620 2:235178120-235178142 GGAGCAAGTGTGGGACAAGCAGG - Intergenic
948470201 2:238172656-238172678 GGCTCAAGACAAGGCCAAGCAGG + Intronic
948829479 2:240591210-240591232 GGAACAAGGGAAGGGAAAGCAGG - Intronic
1170872251 20:20217054-20217076 GGTTCAAGTGAAGGACTTGGAGG - Intronic
1172107853 20:32527457-32527479 GGAGCAAGTGAAGCAGAAACGGG + Intronic
1172301954 20:33856644-33856666 GGCTCAGGTGAAGGAAAAGCTGG - Intergenic
1172778438 20:37421644-37421666 GGATGCAGTGAAGGGCAAGATGG - Intergenic
1172897223 20:38308813-38308835 GGATGGAGTGAAGGACCAGGTGG + Intronic
1173856319 20:46252633-46252655 GGATCAGGAGAAGGAGAAGTGGG - Intronic
1173975036 20:47180500-47180522 GGAACAAGTGTAGGACAAGAGGG - Intronic
1175056101 20:56199709-56199731 GGATAAACTGAAGGGCAGGCAGG - Intergenic
1175761261 20:61563411-61563433 GGAGCAAGTGAGGGAGAAGGAGG - Intronic
1178977381 21:37231569-37231591 GGATCAAGTGAAGGACAAGCTGG - Intronic
1179133708 21:38661133-38661155 GGAGCAAGGGAAGGACCAGAGGG + Intronic
1180913725 22:19470946-19470968 GCACAAAGAGAAGGACAAGCAGG + Intronic
1180946073 22:19694282-19694304 GGATCCAATGCAGGACAAGTAGG + Intergenic
1182549992 22:31095717-31095739 GGGTCTAGAGAAGGAGAAGCTGG - Intronic
1183370807 22:37431134-37431156 TGACCAAGTGAAGAATAAGCTGG - Intergenic
1183539959 22:38424038-38424060 GGATGGAGTGAAGGAGAAGCAGG + Intergenic
950635591 3:14312158-14312180 TGATCAACTGAAGGAAGAGCAGG + Intergenic
951799175 3:26576058-26576080 GCAAAAAGTGAAGGAGAAGCAGG + Intergenic
952962336 3:38600254-38600276 GGCTCAAGTTAAGGACATCCCGG + Intronic
953979427 3:47406258-47406280 GGATAAAGGGAAGGGGAAGCGGG + Intronic
954099273 3:48357081-48357103 GGATCATGTGCTGGAGAAGCTGG + Intergenic
955101840 3:55857937-55857959 GGAGCAGGTGAAGGAGAGGCTGG - Intronic
956327010 3:68064201-68064223 GGATCACGTGAAAAACCAGCTGG + Intronic
958017059 3:87950475-87950497 TGATCAACTGAAGGACCAGAAGG - Intergenic
958481454 3:94650251-94650273 GGATCAAGTAATGGAAAGGCAGG + Intergenic
960222617 3:115132164-115132186 TGATTAAGAGAAGGACAAACTGG - Intronic
964784748 3:160383851-160383873 TGATAAAGTGAAGGACAAGTTGG - Intronic
965151346 3:164980463-164980485 GCATAAATTAAAGGACAAGCAGG + Intronic
968074467 3:195808963-195808985 GGAGCAAGTGCAGGGCAGGCAGG - Intronic
970707682 4:18823886-18823908 GCATAAGGTGAAGGAAAAGCAGG - Intergenic
971144674 4:23963765-23963787 GGATCTACTGCAGGACAACCAGG - Intergenic
971763362 4:30798089-30798111 GGCTCTAGTGGAGGACAAGTTGG + Intronic
981288638 4:143048370-143048392 GAATAAAGTGAAGGAGAAGGAGG - Intergenic
982820348 4:159936995-159937017 GTATTAAGTGTAGAACAAGCTGG - Intergenic
985496158 5:207624-207646 GGCTTATGTCAAGGACAAGCTGG + Intronic
986770463 5:10968222-10968244 GAAACAAGTGAAGGAGAAGATGG - Intergenic
987419409 5:17701038-17701060 GGATACAGTGCAGGACATGCAGG - Intergenic
988903832 5:35763976-35763998 GGGTCAAGTGTAAGACAATCAGG + Intronic
992366746 5:76099784-76099806 GGATGAAGAGAAGGAAAACCTGG - Intronic
992998049 5:82351681-82351703 GGATCCTGTGAAGGGCAAGTTGG + Intronic
993996413 5:94728804-94728826 GAATGAAGTGAATGATAAGCAGG - Intronic
994380714 5:99067814-99067836 GTAGAAAGTGAAGGAGAAGCAGG + Intergenic
994692759 5:103038074-103038096 GGATTATATGAAGGAAAAGCAGG - Intergenic
995152155 5:108861009-108861031 GTATCAAGGGAAGGACCAGGTGG - Intronic
995189607 5:109306738-109306760 GGACAAGGTGAAGGAGAAGCAGG - Intergenic
997694381 5:135849967-135849989 GGAGGAAGTGAGGGAGAAGCAGG + Intronic
1000672361 5:164078324-164078346 GGAGAAAGTGAAGGGGAAGCAGG - Intergenic
1001189535 5:169615573-169615595 GTATCAAGGGAGGGACAAGGTGG + Intergenic
1001836297 5:174835587-174835609 GTATCAAGGGCAGGACAAGGTGG + Intergenic
1003094335 6:3130904-3130926 GGAGCAAAATAAGGACAAGCAGG - Intronic
1003380480 6:5620460-5620482 TGTTCAAATGTAGGACAAGCTGG + Intronic
1003397814 6:5768196-5768218 GAATCAAGTGAAAGTCAACCAGG - Intronic
1003577072 6:7307041-7307063 GAGTCAAGTGAAGGAAAAGGGGG - Intronic
1004071976 6:12307554-12307576 GGCAAAAGTGAAGGACAATCTGG + Intergenic
1005693213 6:28327464-28327486 GGAACATCTGAAGGTCAAGCAGG - Exonic
1005728205 6:28670508-28670530 AGATCAAATGAATGAGAAGCTGG + Intergenic
1006052643 6:31356176-31356198 GGAGAACGGGAAGGACAAGCTGG - Exonic
1006964197 6:37965605-37965627 TCATGAAGTGAAGGACAAGAAGG - Intronic
1007173130 6:39878492-39878514 GAACAAAATGAAGGACAAGCTGG + Exonic
1007246388 6:40466261-40466283 GGATAAAGGGAGGGAAAAGCAGG + Intronic
1007333347 6:41132312-41132334 AGATCAAGTGAAGAGGAAGCTGG + Intergenic
1008131092 6:47720683-47720705 ATATCAAGGGTAGGACAAGCTGG + Intronic
1010025907 6:71216478-71216500 GGGTCAAGAGAAGTACAGGCAGG - Intergenic
1012539886 6:100350217-100350239 GAATCAAAAGAAGGATAAGCAGG + Intergenic
1012716850 6:102685312-102685334 GCAGAAAGTGAAGGAGAAGCAGG + Intergenic
1013031624 6:106339400-106339422 GTATCAGATGAAGGCCAAGCAGG - Intergenic
1013494596 6:110685858-110685880 AGATCAAGTTAAGGACAAGTGGG + Intronic
1015438725 6:133222108-133222130 GGATCAAGGCAAGTGCAAGCAGG - Intergenic
1017010166 6:150058016-150058038 GGAAAAAGGGAAGGAGAAGCAGG + Intergenic
1019383674 7:741404-741426 GGAGGACCTGAAGGACAAGCTGG + Exonic
1021171486 7:17403095-17403117 GGATGGACTGAAGGACAAGTGGG + Intergenic
1022634339 7:32118002-32118024 TGAGCAAGAGGAGGACAAGCTGG + Intronic
1025163019 7:56682507-56682529 GGAGAAAGTGAAGGAGAAGCAGG + Intergenic
1025221513 7:57114349-57114371 GGAGAAGGTGAAGGAGAAGCAGG + Intergenic
1025632295 7:63286017-63286039 GGAGAAGGTGAAGGAGAAGCAGG + Intergenic
1025650266 7:63460210-63460232 GGAGAAGGTGAAGGAGAAGCAGG - Intergenic
1027266080 7:76495989-76496011 GGGTGGAGAGAAGGACAAGCGGG - Intronic
1027317458 7:76994106-76994128 GGGTGGAGAGAAGGACAAGCGGG - Intergenic
1028888603 7:95961883-95961905 GGAGCAAGGGAAGGAAAGGCAGG - Intronic
1031356760 7:120796816-120796838 GGATCAAGTGGAGGACAGACTGG - Intronic
1033098781 7:138453268-138453290 GGATCAAGAGAAGGAAAAGAGGG - Intergenic
1036387338 8:8293986-8294008 GGGTCAAATCAAGGACAAGCAGG + Intergenic
1036468032 8:9021057-9021079 GCAGGAAGGGAAGGACAAGCAGG - Intronic
1042525989 8:69765676-69765698 AGTTCAAGTGCAGGACAAACCGG + Intronic
1042952821 8:74219295-74219317 GGATGAGGGGAAGGACAGGCAGG + Intergenic
1043576501 8:81664689-81664711 GAAACAAGTGAAGGAAAAGTAGG + Intronic
1046152353 8:110244399-110244421 GGATCAAGTTAAGGACATTTAGG - Intergenic
1046251476 8:111637001-111637023 GCATTAGGTGAAGGAAAAGCAGG - Intergenic
1047837144 8:128706677-128706699 GGATCAAGTGAAGATCAACTTGG + Intergenic
1049661123 8:143820176-143820198 CGAGCAAGGGAAGGGCAAGCAGG - Intronic
1051805010 9:20982684-20982706 GGATCAGGTGAAGGACAAAGTGG - Intronic
1055076794 9:72223563-72223585 GTATCAAGTGAAAGAGAAGTAGG - Intronic
1056908928 9:90680211-90680233 GGATAAAGTGAAGGAACAGTTGG + Intergenic
1056951677 9:91045112-91045134 GGATCTAGTGAAGGGCACACAGG - Intergenic
1057488368 9:95504523-95504545 GGATCAAGTGGTGGATGAGCCGG + Intronic
1059891827 9:118812502-118812524 GGGGCAAGTGAAGGGAAAGCCGG + Intergenic
1060801005 9:126545901-126545923 GCATCAGGCGAAGGACAAGGAGG - Intergenic
1061021072 9:128015144-128015166 GTAAGAAGTGAAGGACAGGCTGG - Intergenic
1062038457 9:134393128-134393150 GGACCAAGTGCAGGGCGAGCTGG + Intronic
1186355206 X:8783422-8783444 AGATCAAGTGAGGGACCAGATGG - Intergenic
1189197728 X:39166227-39166249 GGAGCAAGTGAAAGACAAATGGG - Intergenic
1189669462 X:43392583-43392605 GGAGCACGTTAAGGACAAGCTGG - Intergenic
1193427429 X:81356373-81356395 GGAGCAAGTGGAGGAAAAGATGG + Intergenic
1193958470 X:87893386-87893408 AGAACAAGTTAAGGAAAAGCTGG + Intergenic
1194545042 X:95223739-95223761 GGATCTAGAGAAGGAATAGCTGG - Intergenic
1195525428 X:105883721-105883743 AGAACAAGTGAAAGAGAAGCAGG - Intronic
1197390653 X:125859665-125859687 GGATAAAGTGAGGGACAAGGAGG - Intergenic
1197547835 X:127848771-127848793 GGACAACGTGAAGCACAAGCTGG + Intergenic
1198120842 X:133591034-133591056 GAATGAAGTGCAGGACACGCAGG - Intronic
1199602377 X:149549752-149549774 GGATCAGGTGAAGAACCAGATGG + Intronic
1199648011 X:149929723-149929745 GGATCAGGTGAAGAACCAGATGG - Intronic
1199851175 X:151725755-151725777 GGAACAAGTAAAGGACTGGCAGG + Intergenic
1201320010 Y:12688073-12688095 GGATAAAGTGAAGCAAAGGCAGG - Intergenic