ID: 1178980680

View in Genome Browser
Species Human (GRCh38)
Location 21:37261773-37261795
Sequence TGACATTCCCACAGTGCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178980680 Original CRISPR TGACATTCCCACAGTGCATG AGG Intronic
904512093 1:31019783-31019805 TGAAATTCCCAGAGTGAATCGGG + Intronic
908367551 1:63441902-63441924 ATACATTACCACAGGGCATGTGG + Intronic
909568026 1:77077431-77077453 GGTCACTCCCACAGTACATGGGG + Intergenic
912322631 1:108728451-108728473 TGACATTAACACAGGGCATTGGG - Intronic
912739320 1:112178922-112178944 TGTCATTACCACAGTCAATGTGG - Intergenic
915368740 1:155330478-155330500 TGTCATCACCACAGTGGATGAGG + Exonic
916852081 1:168713941-168713963 TGGCATTCCCACAGAGTAGGTGG + Intronic
918403975 1:184193261-184193283 CGCCATTCCCACAGTGTTTGAGG + Intergenic
919214585 1:194535490-194535512 CCGCATTCCCCCAGTGCATGTGG + Intergenic
920561959 1:206945319-206945341 TGCAATTGCCACAGTGCCTGGGG - Intronic
921593680 1:217031880-217031902 TCACATTTCCACAGGGCTTGGGG - Intronic
923958439 1:239049468-239049490 TGACATTTACATAGTGCGTGGGG + Intergenic
924462509 1:244271991-244272013 TAACATTCACACAGTGCTTTTGG + Intergenic
924761490 1:246991657-246991679 TTACATCCCCACAGTGTACGGGG - Intronic
924824638 1:247526554-247526576 TTACATCCCCACAGTCAATGTGG + Intronic
1066700617 10:38123872-38123894 TAACATTTCCACAGTGCACGAGG - Exonic
1067563797 10:47322394-47322416 TGACAAACACACAGGGCATGCGG - Intergenic
1068053017 10:51976148-51976170 TTACATTCCCACAGTATATGAGG - Intronic
1068967058 10:62923300-62923322 TTACATTCCCACTGTGTATAGGG - Intergenic
1069745668 10:70713432-70713454 TGACATGCCCACAGAGCCAGTGG + Intronic
1071921442 10:90355414-90355436 TGACATTTACATAGTACATGGGG + Intergenic
1073478591 10:103771309-103771331 TGAGATTCTCACAGTGCAGAGGG + Intronic
1073798985 10:107020624-107020646 TTATTTTCCCACACTGCATGAGG - Intronic
1074240060 10:111629457-111629479 TGACATTTACATAGTGCACGGGG + Intergenic
1074520341 10:114215164-114215186 TAACAATCTCACAGTGCAGGGGG - Intronic
1075901848 10:126049502-126049524 TGACCTTCCCACATTGCATAGGG - Intronic
1076660967 10:132055935-132055957 GGAGCTCCCCACAGTGCATGCGG + Intergenic
1078074505 11:8145921-8145943 TCACTTACCCACAGTGCATGAGG - Intronic
1080821516 11:35811184-35811206 TGACTTTTCCACAGTGCCTTAGG + Exonic
1081516377 11:43834484-43834506 TCACTGTCCCACAGTGCAGGTGG - Intronic
1081905180 11:46664716-46664738 CCACATGCCCACAGTGCAGGGGG - Intronic
1082944088 11:58739969-58739991 TCCCATTCCCCCACTGCATGTGG - Intergenic
1083802933 11:65057343-65057365 TGGCAGTCCCCCAGTGCAGGAGG - Intronic
1084318621 11:68360617-68360639 TGACCTTCCCTCAGTGCTTCTGG + Intronic
1084456224 11:69269681-69269703 TGAAATTCCCACACTCCTTGAGG - Intergenic
1085770549 11:79321871-79321893 TGATATTCCCACAATGCACAGGG - Intronic
1086425664 11:86680238-86680260 TTAAATTATCACAGTGCATGCGG + Intergenic
1086968913 11:93059263-93059285 AGACATTCCCACAGAGCTTTTGG + Intergenic
1087492757 11:98848981-98849003 CCCCATTCCCCCAGTGCATGTGG - Intergenic
1089864037 11:121616416-121616438 TGCCATTGTCACTGTGCATGTGG + Intronic
1090111536 11:123915416-123915438 TGACAAACCCACAGTAAATGGGG + Intergenic
1090292256 11:125555549-125555571 TGACGTTTACACAGTGCATGGGG + Intergenic
1090392064 11:126395164-126395186 TGGCATTGCCCCAGTGCAGGTGG - Intronic
1090442947 11:126739236-126739258 TGACTTGCCCACAGAGCATTAGG + Intronic
1090975614 11:131677757-131677779 TGACATTTCCTGACTGCATGAGG - Intronic
1091551976 12:1542614-1542636 TGAATTTCACACAGCGCATGAGG - Intronic
1092013857 12:5140144-5140166 CCCCATTCCCCCAGTGCATGTGG + Intergenic
1092025325 12:5234789-5234811 TGACATTCCCATAGCGCAGGTGG + Intergenic
1094610016 12:31986255-31986277 TGACATTCCCACAAGGAATGTGG - Intronic
1095334283 12:41007676-41007698 TGACGTTCACACAATGCATGCGG + Intronic
1097023345 12:56035984-56036006 TCTCAGTCCCACAGTGCCTGGGG - Exonic
1101762246 12:107668532-107668554 TGACATTCCCATTCTGCAGGAGG - Intergenic
1102195401 12:111021783-111021805 TGACCTTCCCACTGTGGGTGAGG - Intergenic
1102762121 12:115397006-115397028 TCTCAGTCCAACAGTGCATGAGG - Intergenic
1104351178 12:128045247-128045269 TGACATTTACATAGTGCATGGGG + Intergenic
1106937086 13:34734879-34734901 TGACATTCCCTGACTCCATGAGG + Intergenic
1107803991 13:44137139-44137161 TCCCCTTCCCACAGTGTATGTGG + Intergenic
1108529704 13:51317385-51317407 TGAAATTCCCACAGTGCCAGGGG - Intergenic
1109929878 13:69201826-69201848 TCCCATTCCCACATTGGATGAGG - Intergenic
1110584023 13:77166531-77166553 TGACATTCCCAGAATGTGTGAGG - Exonic
1110974615 13:81814475-81814497 TTACATTTCCACAGTGTATGAGG - Intergenic
1112515635 13:100050604-100050626 CCCCATTCCCCCAGTGCATGTGG - Intergenic
1116741809 14:48764906-48764928 TTACATTCCCACAGTGTATGAGG - Intergenic
1117008961 14:51450978-51451000 TGACATGCCCACTCTGCAGGTGG - Intergenic
1117192186 14:53304146-53304168 TCAAATTCCCACAGTACAAGGGG - Intergenic
1118134626 14:63009736-63009758 TGCCATACCCACAGAGAATGCGG - Intronic
1120509517 14:85396546-85396568 TGGCCTTCCCACTGTGCTTGTGG - Intergenic
1125195467 15:37041078-37041100 TGGCTTTCCCACAGTGAATAAGG - Intronic
1126268132 15:46779053-46779075 TGACATTCACAAAGCGCATGGGG + Intergenic
1128248555 15:66149367-66149389 TAACATTCCCACTTTGCAGGTGG - Intronic
1128529964 15:68438127-68438149 AGGAATTCCCACAGTGCATAGGG + Intergenic
1128875039 15:71194787-71194809 TTACAATCCAACAGTGCAGGTGG - Intronic
1129700434 15:77764821-77764843 GGACATTCCCCTTGTGCATGTGG - Intronic
1130379877 15:83362422-83362444 TAATATTCCCCCAATGCATGAGG - Intergenic
1132415437 15:101615669-101615691 TGCCACGTCCACAGTGCATGCGG - Intergenic
1132613370 16:828657-828679 GGACCTTCCCAGAGGGCATGGGG - Intergenic
1133109909 16:3541825-3541847 TCACATTTCAACAGTGCACGTGG + Exonic
1134541860 16:15073580-15073602 TGACCTTGCCACAGTGTGTGAGG - Intronic
1134567270 16:15262398-15262420 TGACATTTACATAGCGCATGGGG + Intergenic
1134735221 16:16494302-16494324 TGACATTTACATAGCGCATGGGG - Intergenic
1134932300 16:18217915-18217937 TGACATTTACATAGCGCATGGGG + Intergenic
1137605496 16:49784103-49784125 TTACATTCCCACTGCTCATGAGG - Intronic
1137893775 16:52189325-52189347 TGACATGGCCACAATTCATGGGG - Intergenic
1141720339 16:85752043-85752065 TGACATTCCTTTAGTGAATGTGG + Intergenic
1142004775 16:87684487-87684509 TCCCATTCCCACAGTCCTTGGGG + Intronic
1142334892 16:89481787-89481809 TGACATTCTCACGTTACATGCGG + Intronic
1146738231 17:35258166-35258188 TGAAATTCCCACATAGCTTGAGG - Intronic
1148768041 17:50050783-50050805 TGACATGCCCAAGGTGCAGGAGG - Intergenic
1148992478 17:51678505-51678527 TGAAAATCCCTCAGTCCATGTGG + Intronic
1149456421 17:56792234-56792256 TGATATGCCCACAGTTCACGAGG + Exonic
1150496517 17:65611997-65612019 TGACAATACCACAAGGCATGAGG + Intronic
1151065054 17:71139203-71139225 TGACATAACCACAATGAATGTGG + Intergenic
1152291992 17:79445290-79445312 TGACATTCCCACTGGGCAGTGGG - Intronic
1152588107 17:81198050-81198072 CGCCATTCACACAGAGCATGCGG - Intronic
1153315017 18:3712723-3712745 GGGCTTTCCCACAGTGCATATGG + Intronic
1153704709 18:7733814-7733836 CCCCATTCCCCCAGTGCATGTGG + Intronic
1154993934 18:21622046-21622068 CTACATACCCACAGTGCAGGGGG + Intronic
1158199070 18:54920126-54920148 TGGTGTTGCCACAGTGCATGTGG - Intronic
1158570862 18:58596075-58596097 TAACAGCCACACAGTGCATGCGG - Intronic
1160110681 18:76026947-76026969 GAACATTCCCACAGGGTATGAGG - Intergenic
1160325377 18:77942137-77942159 TGAAATTCCCACCGTGCAAATGG + Intergenic
1160680612 19:410311-410333 GGACATTCCCAGAATGCAGGAGG - Intergenic
1162225241 19:9215672-9215694 TGATATTCCTACCGTGCATATGG - Intergenic
1167563119 19:50238395-50238417 TTACAGACCCACAGTGCATCTGG - Intronic
1168136768 19:54357036-54357058 GGAGATCCCCACAGTGGATGTGG - Intronic
1168449616 19:56455206-56455228 TTACATTCCCACAGTGTACGAGG - Intronic
925203279 2:1986286-1986308 TGGCATTCCCACCATGCATGTGG - Intronic
926045804 2:9708854-9708876 TGACCCTCCCACAGGGCCTGAGG + Intergenic
927064993 2:19462413-19462435 TGACATTTACACAGTCCAGGAGG - Intergenic
927678774 2:25126097-25126119 TGCCACTCTCACAGTGCCTGTGG - Intronic
928382266 2:30828747-30828769 TGACTTAACCACAGTGTATGAGG - Intergenic
930048501 2:47194809-47194831 TGGCACTGCCACAGTGCATTTGG - Intergenic
931663580 2:64593435-64593457 GCACATTCCCAGAGTGGATGAGG - Intergenic
932787529 2:74620463-74620485 CAACATTCCCACAGAGCATTTGG - Intronic
932831946 2:74998764-74998786 TCCCATTTCCCCAGTGCATGTGG + Intergenic
933546000 2:83713261-83713283 TTACATTCTCACAGTGTATAGGG + Intergenic
934038011 2:88104676-88104698 AGACTTTCCCAGAGTTCATGAGG - Intronic
938728306 2:134126042-134126064 AGACATTCCCGCAGTGTCTGCGG + Intronic
939426520 2:142045218-142045240 TACCATTCCCACAGTGCTTCAGG + Intronic
939478680 2:142719567-142719589 TGACATTCCGACGTTGGATGAGG - Intergenic
939481191 2:142748878-142748900 TGACGTTTACATAGTGCATGAGG + Intergenic
940064447 2:149611418-149611440 TGAAAATGCCTCAGTGCATGTGG - Intergenic
941192292 2:162400261-162400283 GGACATCCCCACAGTGAACGAGG + Exonic
942132435 2:172893372-172893394 TGACTTTCACACAGGACATGTGG - Intronic
942619687 2:177833945-177833967 CACCATTCCCCCAGTGCATGTGG - Intronic
942656311 2:178217669-178217691 TGACATTTACATAGTGCATAGGG + Intronic
943490261 2:188544729-188544751 TTACGGTCCCACAGTCCATGAGG - Intronic
944032226 2:195248985-195249007 TCACATTCCAACAGTGCACAAGG - Intergenic
945567059 2:211413972-211413994 CCCCATTCCCCCAGTGCATGTGG + Intronic
946181974 2:217954306-217954328 TGACATTCCCACACAGGATGGGG - Intronic
946403985 2:219483316-219483338 AGACATTCCCACTGAGGATGAGG + Exonic
947560582 2:231146817-231146839 TGACATTCCAAAAGAGAATGTGG - Intronic
947740354 2:232482006-232482028 TGGCATTCACATAGCGCATGAGG - Intronic
947810093 2:232998667-232998689 TGTCTTTCCCACAGTGGCTGTGG + Intronic
948317808 2:237042623-237042645 TAACATTCCCACAATTTATGAGG + Intergenic
948614514 2:239190069-239190091 TGTTTTTCCCACAGTGGATGTGG - Exonic
1169983324 20:11411974-11411996 TGACATTTACATAGCGCATGAGG - Intergenic
1170053477 20:12172824-12172846 TTACTTTCCCACTATGCATGGGG + Intergenic
1170308934 20:14971738-14971760 TGACATTTACATAGCGCATGGGG + Intronic
1171241455 20:23570311-23570333 TGACATTTCGACAGTGCAATGGG - Intergenic
1171428461 20:25063608-25063630 GCACAGTGCCACAGTGCATGAGG - Intergenic
1173798774 20:45881367-45881389 TGACATTCCCAGAGTCCAGCTGG - Intronic
1174909251 20:54588673-54588695 TGACATTTCCACAGATCTTGAGG + Exonic
1177066614 21:16444844-16444866 TGACATCACCACACTGAATGGGG - Intergenic
1178424582 21:32469171-32469193 TGACGTTCCAGCAGTGGATGGGG + Intronic
1178980680 21:37261773-37261795 TGACATTCCCACAGTGCATGAGG + Intronic
1183059269 22:35326312-35326334 AGGCATTCCCAGTGTGCATGAGG + Intronic
1183128557 22:35809902-35809924 TGGAATTCCCACAGAGTATGGGG - Exonic
1184341301 22:43887563-43887585 TGGCAGTCCCACAGTGGCTGGGG - Intronic
949225762 3:1693257-1693279 TGACATTTACATAGTGCATGGGG - Intergenic
949785252 3:7733442-7733464 CCCCATTCCCCCAGTGCATGTGG + Intronic
951392562 3:22124531-22124553 TTATATTCCCACAGTGTATGAGG + Intronic
951616236 3:24548106-24548128 TAACATTCTCACATTGTATGTGG + Intergenic
952158488 3:30669559-30669581 TGACGTTTACATAGTGCATGGGG + Intronic
952189625 3:31008965-31008987 TCACATTCCCACAGTGAGTGAGG - Intergenic
952625004 3:35393016-35393038 CCCCATTCCCACAGTGCATGTGG - Intergenic
954347945 3:50016556-50016578 TTACATTCCCACAGTGTAAAGGG + Intronic
955571811 3:60315189-60315211 AGAGATTCCCACAGGGCATTAGG - Intronic
957475642 3:80719805-80719827 TGCCATTCTCACAGTCCATCTGG - Intergenic
963438403 3:145303349-145303371 TGACTTTTCCAAAGTGCATAAGG + Intergenic
965029274 3:163342402-163342424 TGACGTTTACATAGTGCATGGGG - Intergenic
968885990 4:3332675-3332697 TATCATTCCCGCAGTCCATGAGG - Intronic
970166092 4:13240077-13240099 TGACCTTTCCTCAGTGCTTGAGG - Intergenic
972867569 4:43253193-43253215 TATCATTCCCTCAGTGAATGTGG + Intergenic
973221650 4:47733115-47733137 TTACATTTGCACAGGGCATGTGG + Intronic
974892813 4:67902016-67902038 TTACATTCCCACAGTGTACAAGG + Intergenic
976909504 4:90283932-90283954 TTACATTCCCACTGTGTATAAGG + Intronic
978045748 4:104124874-104124896 TTACATTCCCACAGTGTACAAGG - Intergenic
982555495 4:156857598-156857620 TAACATTCCTTCATTGCATGTGG - Intronic
984844803 4:184100375-184100397 GGACATTCCCACTGTGGAGGTGG - Intronic
986223462 5:5791332-5791354 GGACATGACCACAGGGCATGGGG + Intergenic
986294931 5:6430127-6430149 TTACATTCCCACACCCCATGTGG + Intergenic
986482837 5:8205857-8205879 GGACATTCCCAAGTTGCATGTGG - Intergenic
987504796 5:18754121-18754143 TGAGACTCCCAAAGTGCAAGTGG + Intergenic
989089757 5:37718027-37718049 ACTCATTGCCACAGTGCATGGGG + Intronic
994453924 5:99981277-99981299 CCACATTCCCTCAGTGCATGTGG - Intergenic
995605890 5:113854779-113854801 TTCCATTCCCACCGTGTATGAGG + Intergenic
998899122 5:146833585-146833607 TGTCATTCCCACAGTAGGTGAGG - Intronic
999088254 5:148912328-148912350 TCACATTCACACAGAGCCTGTGG + Intergenic
999637950 5:153641897-153641919 TGACAATCCCAAAGTGGTTGGGG + Intronic
999975637 5:156909338-156909360 TGACATTTACATAGCGCATGAGG - Intergenic
1000518176 5:162266073-162266095 TTACAATCCCACAGAGCAGGAGG - Intergenic
1005182028 6:23116562-23116584 TGACGTTTACATAGTGCATGGGG + Intergenic
1005629190 6:27691709-27691731 TGACTTTCCTTCAATGCATGGGG - Intergenic
1008589917 6:52983756-52983778 TTACATTCACAAAGTGCCTGTGG + Intronic
1009770768 6:68140527-68140549 TGACATTTACAAAGTGCGTGAGG - Intergenic
1010271829 6:73924307-73924329 TGGCATACACACAGAGCATGAGG - Intergenic
1012103313 6:95120136-95120158 TGACATTCCCTCAGCTCTTGAGG + Intergenic
1013112405 6:107074552-107074574 GGACTTTCCCACAGTGCCTCAGG + Intronic
1015740512 6:136448883-136448905 AGTCATTCTAACAGTGCATGAGG - Intronic
1017090701 6:150756179-150756201 TGACTTTCTCAAAGAGCATGGGG - Intronic
1022479423 7:30733372-30733394 AGACCCTCCAACAGTGCATGTGG + Intronic
1026225738 7:68438758-68438780 TTACATTCTAACAGTGTATGAGG - Intergenic
1026257695 7:68726706-68726728 TGTCATCCACACAGTGCATTAGG + Intergenic
1028031429 7:85919063-85919085 TGATATTCCCACAGAGGCTGAGG - Intergenic
1028251019 7:88540213-88540235 TGACATTTACATAGTGCATGGGG + Intergenic
1028469366 7:91187799-91187821 TGACATCTACATAGTGCATGGGG + Intronic
1029223808 7:99010446-99010468 AGCCATTCCCACAGAGCACGTGG + Intronic
1031757216 7:125660199-125660221 TGACCTTTCCACAGTGCATGGGG - Intergenic
1033676524 7:143545477-143545499 TGGCATTCCCACTGTGTTTGTGG - Intergenic
1033695309 7:143783962-143783984 TGGCATTCCCACTGTGTTTGTGG + Intergenic
1035261432 7:157663994-157664016 GGACATTTCCACCCTGCATGAGG + Intronic
1035874475 8:3172710-3172732 TGACCTTCACAGAGTGCATGTGG - Intronic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1035934883 8:3825752-3825774 CTACATTTCCACAGTTCATGTGG - Intronic
1037103583 8:15078012-15078034 TCCCAGTCCCCCAGTGCATGGGG - Intronic
1037588528 8:20294661-20294683 GGGCATTTCCACAGTGCAAGGGG - Intronic
1037820526 8:22132738-22132760 TGACATCCCCAAAGGGGATGGGG + Intronic
1039914988 8:41853107-41853129 TGAGATTCCCCCAGTGCATTCGG + Intronic
1042225316 8:66510746-66510768 TGGCCTTCCCTCTGTGCATGTGG + Intronic
1042477535 8:69266028-69266050 TGGCATTCTCAGAGTGGATGCGG - Intergenic
1044033546 8:87268558-87268580 TTACATTCCCACAATGCTGGTGG - Intronic
1046488399 8:114915982-114916004 TGACTTTTACATAGTGCATGAGG + Intergenic
1055436334 9:76295775-76295797 TTAGATTCTTACAGTGCATGGGG - Intronic
1055803591 9:80067981-80068003 TGGGATTCCAACAGTGAATGTGG + Intergenic
1056245371 9:84689480-84689502 TGACAATCCCAGAGTCCAGGAGG - Intronic
1057055988 9:91961215-91961237 TGTCCTTCCCACACTGCATCTGG - Intergenic
1058049968 9:100395581-100395603 TGACATTTACACAGTGCTTGGGG + Intergenic
1060467793 9:123922825-123922847 TGACATTCCAAAAGTTCATTTGG - Intronic
1188179318 X:27034581-27034603 TCCCATTCCCCCAGTGCATGTGG + Intergenic
1189445836 X:41080598-41080620 AGACATTCCCACAGAGCAGGAGG + Intergenic
1189947737 X:46196261-46196283 CCCCATTCCCACAGTGCATTTGG - Intergenic
1190081889 X:47363111-47363133 AGACATCCCCACAGTTCCTGTGG - Intergenic
1190372123 X:49752898-49752920 TCTCATACACACAGTGCATGAGG + Intergenic
1191013614 X:55787137-55787159 TGACACTGCCACAGTGAATCAGG + Intergenic
1193055027 X:77140967-77140989 TCACAGTTCCACAGTGCCTGGGG - Intergenic
1193450402 X:81658271-81658293 TGACAACTCCACAGGGCATGAGG - Intergenic
1193790648 X:85812236-85812258 TGACATTTACATAGTGCATGGGG - Intergenic
1194843740 X:98776882-98776904 GGTCCCTCCCACAGTGCATGGGG - Intergenic