ID: 1178986807

View in Genome Browser
Species Human (GRCh38)
Location 21:37311902-37311924
Sequence ATTCTAATCTGATTAAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178986807_1178986809 -8 Left 1178986807 21:37311902-37311924 CCACCTTTTAATCAGATTAGAAT No data
Right 1178986809 21:37311917-37311939 ATTAGAATTTTTTCCCATACAGG No data
1178986807_1178986812 17 Left 1178986807 21:37311902-37311924 CCACCTTTTAATCAGATTAGAAT No data
Right 1178986812 21:37311942-37311964 TTTGAGCTCCTTATATATTCTGG 0: 513
1: 1028
2: 1628
3: 4057
4: 20078

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178986807 Original CRISPR ATTCTAATCTGATTAAAAGG TGG (reversed) Intergenic
No off target data available for this crispr