ID: 1178988878

View in Genome Browser
Species Human (GRCh38)
Location 21:37334869-37334891
Sequence CCAAATTTTGGCCAGCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178988874_1178988878 -5 Left 1178988874 21:37334851-37334873 CCACACACTTTTAAACAACCAAA No data
Right 1178988878 21:37334869-37334891 CCAAATTTTGGCCAGCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178988878 Original CRISPR CCAAATTTTGGCCAGCATGG TGG Intergenic