ID: 1178992449

View in Genome Browser
Species Human (GRCh38)
Location 21:37367036-37367058
Sequence CGCTGCCGCCGCCGGCGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 306}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178992442_1178992449 23 Left 1178992442 21:37366990-37367012 CCGCCGCCGCTTCTGCTGCTGCT 0: 1
1: 19
2: 77
3: 357
4: 1187
Right 1178992449 21:37367036-37367058 CGCTGCCGCCGCCGGCGAGCAGG 0: 1
1: 0
2: 5
3: 50
4: 306
1178992444_1178992449 17 Left 1178992444 21:37366996-37367018 CCGCTTCTGCTGCTGCTGTTCCT 0: 1
1: 1
2: 12
3: 199
4: 1041
Right 1178992449 21:37367036-37367058 CGCTGCCGCCGCCGGCGAGCAGG 0: 1
1: 0
2: 5
3: 50
4: 306
1178992443_1178992449 20 Left 1178992443 21:37366993-37367015 CCGCCGCTTCTGCTGCTGCTGTT 0: 1
1: 3
2: 44
3: 239
4: 845
Right 1178992449 21:37367036-37367058 CGCTGCCGCCGCCGGCGAGCAGG 0: 1
1: 0
2: 5
3: 50
4: 306
1178992446_1178992449 -3 Left 1178992446 21:37367016-37367038 CCTGCTGCTGCTGTTGGTGCCGC 0: 1
1: 0
2: 10
3: 147
4: 573
Right 1178992449 21:37367036-37367058 CGCTGCCGCCGCCGGCGAGCAGG 0: 1
1: 0
2: 5
3: 50
4: 306
1178992441_1178992449 26 Left 1178992441 21:37366987-37367009 CCGCCGCCGCCGCTTCTGCTGCT 0: 1
1: 15
2: 78
3: 302
4: 1334
Right 1178992449 21:37367036-37367058 CGCTGCCGCCGCCGGCGAGCAGG 0: 1
1: 0
2: 5
3: 50
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178992449 Original CRISPR CGCTGCCGCCGCCGGCGAGC AGG Intronic
900091919 1:924387-924409 TGCTGCCGCCGGCGGAGAGCGGG + Intergenic
901443540 1:9293319-9293341 CGCTGCCGCCGCTGCAGGGCAGG + Intronic
902501429 1:16914093-16914115 CGCTGCTGCCGAGGCCGAGCGGG - Intronic
903324742 1:22563451-22563473 CGCCGCCGCCGCCGCCGCCCCGG - Intergenic
903829123 1:26164416-26164438 CGCCGCCGCCGCCTGCGAGGGGG + Intergenic
904181297 1:28668699-28668721 GGCCGCCGCCGCCGGAGAGCTGG - Intergenic
904642013 1:31938139-31938161 CGCCGCCGCCGCCGCCGGGCCGG - Exonic
904719956 1:32500481-32500503 CGCCGCCGCCGCCCGCTACCAGG - Intronic
904769067 1:32870913-32870935 CGCCGCCACCGCCGCCGCGCGGG - Intronic
904822951 1:33256822-33256844 CGCCGCCGCCGCCGCCGCTCTGG - Intronic
905862636 1:41361483-41361505 TGCTGCCGCCGCCGCCGCTCCGG - Intergenic
906961419 1:50421483-50421505 CGCCGCCGCCGTCGCCGCGCCGG + Exonic
907069329 1:51519407-51519429 CGCGGCCGGCTCCGGCGGGCGGG - Intergenic
907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG + Intronic
907222990 1:52921176-52921198 CGCTGCCTCCGCCCCCGAACCGG + Intronic
910448995 1:87328536-87328558 CGCCGCCGCCGCCTCCGAGCCGG + Exonic
912246338 1:107965123-107965145 CGCGGCAGCCGCCGCCGAGCCGG - Exonic
915902130 1:159854845-159854867 CGCCGCCGCCGCCTGCGAAGCGG - Exonic
916920400 1:169460472-169460494 AGCGCCCGCCGCCGGCTAGCCGG + Exonic
918423487 1:184386729-184386751 CCCTGCAGCGGCCGGCCAGCCGG - Intergenic
919165459 1:193885709-193885731 CGCTGCTGCAGCCGGCAAGATGG + Intergenic
920333307 1:205227909-205227931 GGCTGCCTCCGCCCGGGAGCGGG - Intergenic
920352170 1:205344308-205344330 CGGAGCCGCCGCCGGGGAGGAGG + Exonic
921023823 1:211259632-211259654 CGCTGCCGCCGCCGCCTGCCGGG - Exonic
921155066 1:212432953-212432975 CGCAGCCGCCGCCGCGGCGCGGG - Exonic
921866614 1:220093991-220094013 CCCTGCAGCCGCCGGGGGGCGGG - Intergenic
922514525 1:226197158-226197180 CGCTACCGTCTCCGGCCAGCAGG - Intergenic
1064208971 10:13347776-13347798 CGCCGCCGCCGCCGCCGCGCGGG - Intronic
1064645441 10:17454592-17454614 TGCTGCCGCCGCCGCCGCGCGGG + Intergenic
1066464523 10:35640838-35640860 CCCTGCCGCCGCCGCGGTGCGGG + Exonic
1067560379 10:47300783-47300805 CGCGGCCGCCGACGGCCTGCAGG + Exonic
1069019171 10:63466092-63466114 CGCTGCCGCCTCCGCAGGGCCGG - Intergenic
1069698356 10:70404351-70404373 CGCCGCCGCCGCCTGCCCGCCGG + Intergenic
1070800780 10:79243342-79243364 CGCCGCCGCCGCCGCCGAGGAGG - Intronic
1072454109 10:95561264-95561286 CGGCGCTGCCGCCGCCGAGCGGG + Intronic
1072719503 10:97771935-97771957 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1074814504 10:117134310-117134332 CGCAGCCGCCGCCGCCGCCCCGG - Exonic
1074843281 10:117375434-117375456 CGCTGCCGCCGCCGCCACACCGG - Exonic
1076638910 10:131901015-131901037 CGCCGCCGCCGCCGCCGGGGAGG - Exonic
1079251615 11:18791536-18791558 GGCTCCGGGCGCCGGCGAGCAGG + Exonic
1083595546 11:63916959-63916981 CGCCGCCGCCGCCGGTGCCCCGG - Intergenic
1083669594 11:64292477-64292499 CACAGCCGCAGCGGGCGAGCAGG + Intronic
1084212299 11:67629853-67629875 CGCTGCCGCCGGCTGCTGGCAGG - Exonic
1084474421 11:69380757-69380779 CCCTGCAGCCGCCGGGAAGCTGG - Intergenic
1084680102 11:70662033-70662055 CGCTGCCGCCGCCGCCGTTCGGG - Intronic
1084873375 11:72112660-72112682 GGCTGCTGCCGGCGGCGACCCGG + Exonic
1085485667 11:76860952-76860974 CGCCGCCGCCGCCGCCGCCCAGG - Exonic
1085561272 11:77474211-77474233 CGCAGCCGCCGCCGCCGCGCCGG - Intronic
1087672752 11:101127549-101127571 CTCTGCCGCCGCCGCCGGGGCGG - Exonic
1089543664 11:119206281-119206303 CGCCGCCGCCGCCGGCTATCCGG - Exonic
1089554896 11:119310875-119310897 AGCTGCCGGAGCCGGAGAGCCGG - Exonic
1089993427 11:122882898-122882920 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1091403669 12:196098-196120 AGCTGCGGCCGCCGGCCTGCAGG - Intronic
1091474048 12:753982-754004 CGCTGCCGCCCCTGGGGAACAGG + Exonic
1091550289 12:1530984-1531006 CGCCGCCGCCGCCGCCGCCCCGG + Intronic
1091823166 12:3491295-3491317 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1094025688 12:25958485-25958507 CTCTCCCGGCGCCGGCGAGCGGG + Intergenic
1096482476 12:51951791-51951813 ACCCGCCGCTGCCGGCGAGCAGG - Exonic
1096994341 12:55829603-55829625 CCCCGCGGCCGCCGGCGACCTGG + Exonic
1097107671 12:56634956-56634978 CGCCGCCGCCGCCTGCGGCCCGG - Intronic
1097284237 12:57865377-57865399 CGCTTCCCCCGCCGGAGCGCCGG + Intergenic
1098369169 12:69738996-69739018 CGCGGCCGCTGCCGGCGCTCAGG - Intronic
1098426061 12:70366537-70366559 CGCTGCCGCCGCCGCCGCCGGGG + Exonic
1101605887 12:106247626-106247648 CGCCGCCGCCGCCGCCGCGGTGG + Exonic
1103400723 12:120641164-120641186 CGCCGCTGCCGCCGGCCCGCGGG + Exonic
1103407702 12:120687355-120687377 TGCTGCTGCCGCCGGCGATCCGG + Exonic
1103509866 12:121467020-121467042 TGCTGCCGCTGCCGGCGGGGCGG - Intronic
1103649638 12:122422634-122422656 CGCCGCCGCCGCCGCGGGGCCGG + Intergenic
1103899306 12:124295230-124295252 CGCGGCCCACGGCGGCGAGCAGG + Intronic
1104041423 12:125133784-125133806 CTCTGACACCGCCGGCGAGGAGG - Intronic
1105454343 13:20526199-20526221 CGCTGCCGCCAACTGCGAACTGG + Intergenic
1105472168 13:20704021-20704043 TGCTGGCGCTGCCGCCGAGCTGG + Exonic
1106269362 13:28138710-28138732 CACCGCCGCCGCCAGCGAGGAGG - Exonic
1106340284 13:28820398-28820420 CGCCGCCGCCGCCGGCTCTCAGG + Exonic
1108541498 13:51451736-51451758 CGCCGCCGCCGCTGCCGGGCCGG + Intronic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1113201225 13:107868339-107868361 CTCCGCAGCCGCGGGCGAGCTGG + Intergenic
1113656040 13:112068236-112068258 CGCCGCCGCCGCCACCGAGCCGG - Exonic
1113724501 13:112588100-112588122 CGCGGGCGCCGCCGGCCACCAGG + Exonic
1116821762 14:49634051-49634073 CGCCGTCGCCGCCGCCGCGCCGG - Exonic
1117315250 14:54566468-54566490 CGTGGCCGCCGCCGGCGGGGAGG - Intergenic
1117920292 14:60721695-60721717 CGCCGCCTCCGCTCGCGAGCCGG - Intronic
1119303959 14:73592118-73592140 CGCCGACGCCCGCGGCGAGCTGG + Exonic
1119319095 14:73718881-73718903 CGCCGCCGCCGCCCACCAGCAGG - Exonic
1122231199 14:100306975-100306997 CACCGCCGCCGCGGGCGCGCAGG - Intergenic
1122264204 14:100539129-100539151 CGATGCCTCCGCCCGCGACCTGG - Exonic
1122445014 14:101761778-101761800 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1122779117 14:104136250-104136272 CGCTGTCGGCGCAGGCGGGCGGG + Intergenic
1123480670 15:20628682-20628704 CGGTGCTGCCGGCGGCGGGCGGG + Intergenic
1123637339 15:22371685-22371707 CGGTGCTGCCGGCGGCGGGCGGG - Intergenic
1124038954 15:26082556-26082578 TGGTGCCGCCTCCCGCGAGCCGG - Intergenic
1124109482 15:26773046-26773068 CGCCGCCGCCGCCGCCGCGCTGG + Exonic
1124971146 15:34490544-34490566 CGCCGCCGCCGCCTCCGTGCTGG + Intergenic
1125674249 15:41494062-41494084 CGCTGCGGCCGCCGCCGCGGGGG + Exonic
1126823650 15:52528891-52528913 CGCAGCCGCCGGCAGGGAGCAGG + Exonic
1126849734 15:52789692-52789714 CGCCGCTGCCGCCGTCCAGCAGG + Exonic
1127084056 15:55408315-55408337 GGCTGCAGACGCCTGCGAGCAGG - Intronic
1130076692 15:80695621-80695643 CGCCGCCGCCGCGGCCCAGCCGG + Exonic
1130908604 15:88256350-88256372 CGCCGCCGCCGCCGCCGGGTGGG + Exonic
1131375011 15:91916133-91916155 CGATGCCGCCGCAGCCGATCAGG - Exonic
1131827011 15:96330395-96330417 CGCCGCCGCCGCCGCCGAGAGGG - Intronic
1132111521 15:99105329-99105351 CGCGGCCGGCGCGGGCGAGAGGG + Exonic
1132491560 16:234687-234709 CGCTGCCTCCGCCGGGAACCTGG - Exonic
1132653145 16:1030625-1030647 CGCAGCGGCCGCCAGGGAGCGGG - Intergenic
1133784352 16:8963358-8963380 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1134615765 16:15650253-15650275 CTCTGCCGCCGCCGCCGCGTTGG + Intronic
1135158475 16:20073677-20073699 CGCCGCCGCCACCACCGAGCCGG - Exonic
1135479944 16:22814178-22814200 CGCTGGCGCCGGCCGCGATCTGG - Exonic
1135517682 16:23149220-23149242 GGCCGCCGGCGGCGGCGAGCGGG - Exonic
1136365176 16:29806409-29806431 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1136588488 16:31202727-31202749 CGCTGCAGCCGCCGACCAGGAGG + Exonic
1138179270 16:54931149-54931171 CGCCGCGGCCGCCAACGAGCCGG - Exonic
1138360687 16:56425189-56425211 CGAGGCCGGCCCCGGCGAGCCGG - Exonic
1138360746 16:56425436-56425458 TGCCGCCGCCGCCGCCGCGCCGG + Exonic
1139761414 16:69187322-69187344 CGACGCCGCCGCGGCCGAGCTGG + Exonic
1140223270 16:73058763-73058785 GGCGGCCGCAGCCGGGGAGCCGG + Intronic
1140354881 16:74297057-74297079 CGCGGCGGCCGCGGACGAGCTGG + Intronic
1141531428 16:84649013-84649035 CGGAGACCCCGCCGGCGAGCCGG + Intronic
1142118934 16:88376509-88376531 CTCTGCCGCCGCCCGTGAACGGG + Intergenic
1142215029 16:88825862-88825884 AGCTGCCGCCTCCGGCTATCTGG - Intronic
1142417004 16:89948709-89948731 TGCTGCCGCCTCCGGCGCGGAGG - Intronic
1142764328 17:2057104-2057126 CGCCGCCGCCGCCGCCCCGCAGG - Exonic
1144339730 17:14301589-14301611 CGCCCCCGCCGCCGGTGAGGAGG + Exonic
1145012587 17:19378321-19378343 GGCGGCTCCCGCCGGCGAGCTGG + Intronic
1145214936 17:21043688-21043710 CGCTGCCCCCGGCCGCAAGCTGG + Intronic
1146132628 17:30291949-30291971 CGCCGCCGCCGCCGCCGAGCCGG - Exonic
1146332333 17:31937413-31937435 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1147161783 17:38572827-38572849 CGCCGCGGCCGCCGCCGTGCCGG + Intronic
1147200647 17:38799427-38799449 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1147719826 17:42532207-42532229 CGCCGCCGCCGCCGCCGCCCAGG + Intergenic
1147967395 17:44200339-44200361 CGCTGCCCCCGCCCCCGAGCCGG - Intergenic
1147971294 17:44220067-44220089 TGCTGCCGCCGCCGGGGAAGGGG + Intronic
1147971653 17:44221471-44221493 CCCTGCCGGGGCCGGCGAGACGG + Exonic
1148356381 17:46978544-46978566 CTCTGCCGCCGCCTCCGGGCGGG - Exonic
1148556595 17:48582224-48582246 CGCCGCCGCCGCCGGTGCGCAGG - Intronic
1148561913 17:48611204-48611226 CGCTGCCGACTCCCGCGGGCTGG + Intronic
1148698631 17:49575659-49575681 CGCCGCCGCCGCCGGTGGGAGGG + Intergenic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1150168366 17:62966225-62966247 CGCTAGCGCCGCCGCCGCGCTGG - Intergenic
1151802079 17:76384618-76384640 CGCAGCCGGCGCCGCGGAGCGGG - Intronic
1153382603 18:4455383-4455405 CGCGGCCGCCGCCCGCCCGCCGG - Intergenic
1156171703 18:34493858-34493880 CGCGGCCGGCGCCGGCGCACAGG - Intronic
1156213839 18:34976943-34976965 CGCCGCCGCCGCCGCCGCTCCGG - Intronic
1158695185 18:59697319-59697341 TGGTGCCGCCGCCTCCGAGCCGG - Exonic
1160204673 18:76822794-76822816 CGCCGCCGCCGCCGACTGGCCGG + Intronic
1160453356 18:78979805-78979827 CGCCGTCTCCGCCGGCGCGCCGG - Intergenic
1160763559 19:797553-797575 CCCTGCCCCCGCCGCCGCGCCGG + Intronic
1160788737 19:913172-913194 CGCCGCCGCCGCCGCCCGGCAGG + Exonic
1160873168 19:1286079-1286101 CGCCGCCGCCGCCGCCGAGCGGG - Intergenic
1160930600 19:1568019-1568041 CGCCCCCGCCGCCGTCGGGCTGG + Exonic
1160967693 19:1753818-1753840 CGCCGCCGCCGCCGTCCAGCAGG - Exonic
1161031893 19:2061441-2061463 CGCGGCCGCCGCCGGGGAGGGGG - Intergenic
1161072688 19:2270501-2270523 CGCGGGGGCCGCCGGGGAGCTGG + Intronic
1161628764 19:5340883-5340905 CGCCGCCGCCGCCGCCGGGTCGG + Intergenic
1161703248 19:5805944-5805966 CGCCGCCGCCGCCGGGGACACGG + Intergenic
1162470892 19:10871558-10871580 CGCCGCCGCAGCCGCCGTGCAGG - Exonic
1165533258 19:36421685-36421707 CGCCGACGCCCGCGGCGAGCTGG + Intergenic
1166536077 19:43575597-43575619 CGACGCCGGCGCCGGCGCGCCGG - Exonic
1166543287 19:43619578-43619600 TGCAGCCGCCGCCGCAGAGCCGG - Exonic
1166790616 19:45396572-45396594 CGCTGCCGCCGGAGCCTAGCAGG + Exonic
1166807694 19:45496977-45496999 CGCCGCCGCCGCCGCCGCCCTGG + Exonic
1166883068 19:45940582-45940604 CGCCGCCGCCTCCGGCCTGCTGG - Exonic
1167334472 19:48875918-48875940 CGCTGCAGCAGCAGACGAGCGGG - Exonic
1167410198 19:49339759-49339781 CGCCGCCGCCGTCAGCGATCAGG - Intronic
1167557473 19:50205306-50205328 CGCCGCCGCCGCCGCCCACCTGG + Intronic
928964832 2:36966355-36966377 GGCTGCCGCGGCCGGCGACGGGG - Exonic
929188708 2:39120740-39120762 CGCGGCCGCCGCCCGCCCGCCGG + Intronic
929701408 2:44166331-44166353 CGCTGCCGGCGCCCGCGCTCAGG + Intergenic
929983220 2:46699572-46699594 CGCTGCCTCCGCCGCGGTGCGGG - Intronic
931253503 2:60552413-60552435 CGCCGCCGCCGCCGAAGGGCAGG - Intronic
931321564 2:61178038-61178060 CGCAGGCGCCTCCCGCGAGCCGG + Exonic
932231343 2:70086880-70086902 ACCGGCCGCCGCCGGGGAGCAGG + Intergenic
932599189 2:73112453-73112475 CTCCGCCGCCGCCTGCGAGCTGG - Exonic
933684709 2:85133690-85133712 CGCCGCCCCCGCCGCCGAGCTGG - Exonic
934031903 2:88055744-88055766 CGCCGCCTCCGCCGCCGAGCAGG + Intergenic
934261193 2:91478105-91478127 CGCCGCCGCCGCCGCCGCCCCGG + Intergenic
934296795 2:91748939-91748961 CGCCGCCGCCTCCAGCGCGCGGG + Intergenic
935592617 2:104855837-104855859 CGCTGCCGCCGCCGCCGCCGTGG + Exonic
935592778 2:104856383-104856405 CGCCGCCGCCGCCGTGGTGCGGG - Exonic
935696764 2:105777105-105777127 CACTGCTGCTGCCGCCGAGCAGG + Intronic
940639922 2:156334317-156334339 CTCCCCAGCCGCCGGCGAGCTGG - Intronic
941029311 2:160493439-160493461 CGCTGCCGCCGCCGCCGGAAAGG - Exonic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
942748719 2:179264623-179264645 CGCTGCTGCCGCCGCCGCCCGGG - Exonic
943580119 2:189674582-189674604 CACTGCCGCCGCCCGGGCGCGGG - Intronic
945431725 2:209772234-209772256 CGCTGCCGCCGCCGCCGCTGAGG + Intronic
945891598 2:215436191-215436213 GGCTGCGGCGGCCGGCGGGCGGG - Intergenic
945955420 2:216081879-216081901 CTTTGCCGCGGCCGGCGGGCGGG - Exonic
946191646 2:218010687-218010709 TGCTGCCGCCGCCGCCGCCCCGG - Intergenic
946295772 2:218782324-218782346 CGTTGCCGCCGCCGGACACCAGG - Exonic
946767346 2:223052899-223052921 CGCTGCCGCCGCCGGCCGCACGG - Exonic
947741334 2:232486374-232486396 CGCCGCCGCCGGCCGCGACCGGG + Exonic
948116007 2:235494581-235494603 CGCCGCAGCCCCCGGGGAGCCGG - Exonic
948487208 2:238288588-238288610 CGTAACCGCCGCCGGCGCGCGGG - Exonic
1169065684 20:2693164-2693186 CGCTGGCGCCGCGGGCGGGCGGG + Intronic
1169214873 20:3786915-3786937 TGCTGCGGCCTCCGGCGACCCGG + Intronic
1169244540 20:4015386-4015408 CGCGGCCGCCGCCCCCGGGCTGG - Intronic
1169664522 20:8019500-8019522 CGCTGCCGCCGGAGCAGAGCCGG - Exonic
1170150267 20:13220988-13221010 CGCTGCCGCCGAGGGCGCCCCGG + Intergenic
1172083252 20:32358753-32358775 TGCCGCCGCCGCCGGGGAGAAGG + Exonic
1172271975 20:33659947-33659969 CTCTGCGGCAGCCGGCGGGCAGG - Exonic
1172640189 20:36436105-36436127 CGCCGCCGCCGCCGGGCACCTGG - Exonic
1175439602 20:58981409-58981431 CGTCTCCGCCGCCGGCGGGCCGG + Intronic
1175847371 20:62065825-62065847 CGCCGCCGCCGCCGCCGCTCGGG + Intergenic
1176207109 20:63895197-63895219 CGCCGCCGCCGCCGCCGCCCGGG + Exonic
1176548597 21:8212233-8212255 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176550059 21:8217092-8217114 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1176556491 21:8256441-8256463 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176567528 21:8395268-8395290 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176568986 21:8400127-8400149 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1176575430 21:8439483-8439505 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176576900 21:8444362-8444384 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1177011057 21:15730369-15730391 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
1178334589 21:31732026-31732048 CACTGGCCCGGCCGGCGAGCGGG + Exonic
1178992449 21:37367036-37367058 CGCTGCCGCCGCCGGCGAGCAGG + Intronic
1180831059 22:18906342-18906364 CGCTGCAGCCGGCGGCTAGCGGG + Exonic
1180840887 22:18958348-18958370 CGCAGCCGCCGCCTGCTCGCCGG + Intergenic
1180891407 22:19291655-19291677 CGCTGCCGCCGCCGCCGCCGAGG - Exonic
1180960679 22:19761032-19761054 CGCCGCCGCCCCCGGCGCCCCGG + Exonic
1181060603 22:20280426-20280448 CGCAGCCGCCGCCTGCTCGCCGG - Intronic
1181068784 22:20319999-20320021 CGCCGCCGCCGGCGGCTAGCGGG - Exonic
1181478092 22:23180833-23180855 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1182236952 22:28883653-28883675 CGCCGCCGCCGCCGCCGTGATGG + Exonic
1184153154 22:42649823-42649845 CGGAGGCGCCGCCGGCGAGGAGG - Intergenic
1184472258 22:44702543-44702565 GGCCGCCGCCGCGGACGAGCGGG + Exonic
1184767035 22:46577398-46577420 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1185397611 22:50600862-50600884 CGCTGTCGCCGCCGGGCTGCAGG + Exonic
1203238469 22_KI270732v1_random:30916-30938 CGCCGCCGCCGCCGCCGGGGCGG + Intergenic
1203254949 22_KI270733v1_random:133418-133440 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1203261535 22_KI270733v1_random:173616-173638 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203263005 22_KI270733v1_random:178497-178519 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1203281146 22_KI270734v1_random:131613-131635 CGCTGCAGCCGGCGGCTAGCGGG + Intergenic
949559399 3:5188017-5188039 GGCTGCAGCCGCCGGGGACCGGG + Exonic
950168026 3:10816206-10816228 CGCCGCCGCCCCGGGCGAGCTGG - Exonic
950729784 3:14947603-14947625 CGCCGCCGCCGCCCGCGCGCTGG - Intronic
953891663 3:46755847-46755869 TGTTGCCGCCGCCGCCGATCTGG - Intronic
954408681 3:50359528-50359550 CGCTGCCGCCGGGGACGCGCAGG - Exonic
954779071 3:53046019-53046041 CGCCGCCTCCGCCGGAGCGCGGG - Exonic
959530734 3:107431541-107431563 CGCCGCCGCCGCCGGGGCTCGGG + Intergenic
960577149 3:119240820-119240842 CGCTGGCTCCGCCGGCGCCCGGG - Intronic
960664217 3:120094381-120094403 CGCCGCCGCCGCCGCCGCCCGGG - Intronic
961176892 3:124842995-124843017 CGCTGCCGCCGGCCCCGAGAGGG - Intronic
961574454 3:127823222-127823244 GGCCGCCCCCGCCGCCGAGCCGG - Intronic
962301893 3:134250658-134250680 CGCCGCCGCCGCCGCCGAAGAGG + Exonic
963602580 3:147390954-147390976 CGCCGCCACCGCCGCCGAGGAGG + Exonic
966449045 3:180037016-180037038 CGCCGCCGCAGCTGCCGAGCGGG + Intronic
966878358 3:184336160-184336182 GGCTGCGGCCGCCGGTGCGCGGG + Intronic
967880327 3:194297184-194297206 CGCCGCCGCCGCCAGCTTGCTGG + Intergenic
967904101 3:194486792-194486814 CGCCGCCGCCGCGGGCGCGGAGG - Intronic
967924184 3:194633377-194633399 CGCCGCCGCCGCCCGCGCCCGGG - Exonic
968727687 4:2255887-2255909 GGCTGCCGCTGCCGGGGAGCTGG + Intronic
970333008 4:15003720-15003742 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
971019071 4:22516107-22516129 GGCGGCCGCCGGCGGCGGGCGGG - Intergenic
975118592 4:70705254-70705276 TGCTGCCGCCGCCGCCGCTCGGG - Intronic
975986117 4:80202701-80202723 CGCCGCCGCCGCCAGCGTCCTGG - Exonic
976390403 4:84499391-84499413 GGCTGCGGGGGCCGGCGAGCCGG + Intergenic
978072541 4:104491325-104491347 CGCCGCCACCGCCGGCGGGGAGG + Exonic
979685316 4:123505639-123505661 CGCTGCCGCCGCCGCCGCCGAGG + Intergenic
981270744 4:142845723-142845745 CGCCGCCGCCGCCGCCGGCCTGG - Intronic
981550610 4:145937754-145937776 CGCTGCCGCCGGCGGCTCGGGGG + Intronic
981782376 4:148443714-148443736 AGCTGCCGCCGCCGGGCTGCGGG - Intronic
982460955 4:155667803-155667825 CGCTGCGGCCTCCGGCGCGCCGG + Intronic
986747923 5:10760795-10760817 CTTCGCCGCCGCCGGCAAGCGGG + Intronic
986813630 5:11385047-11385069 CGCTGCCCGCGCCGCCGCGCGGG - Exonic
986858799 5:11903701-11903723 CGCCGCCGCCGCCTGCCGGCCGG + Intronic
989229991 5:39074479-39074501 CGCCGCCGTCGCCGCCGAGGGGG - Intergenic
989812671 5:45696209-45696231 CGCCGCCGCCGCCGCCGCGACGG - Intergenic
990955023 5:61332320-61332342 CGCCGCCGCCGCCGCCCGGCCGG - Exonic
990955148 5:61332806-61332828 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
992067457 5:73120711-73120733 CGCCGCCGGCGCAGGCGCGCGGG - Intronic
992105521 5:73447213-73447235 CGCTGCCGCCGCCGCCGCGCAGG - Exonic
992105782 5:73448196-73448218 CGCCGCCGCCGCCGCTGCGCGGG + Exonic
993900909 5:93584070-93584092 CGAGGCTGCCGCCGGCGATCAGG - Exonic
996862877 5:128084506-128084528 CGCCGCCGCCGCCGGAGTGCAGG - Exonic
997539321 5:134648701-134648723 CGCAGCAGCCGCCGCCGCGCCGG - Intronic
1000210081 5:159100449-159100471 GCCTGGCGCCGCCAGCGAGCCGG - Intergenic
1000318962 5:160118942-160118964 CGCTCGTGCCGCCGGCGGGCGGG - Exonic
1001522410 5:172404018-172404040 GGCTGCCGCAGCTGGCCAGCGGG + Intronic
1001639130 5:173232893-173232915 CGCCGCCGCCGCCTGCCCGCAGG - Exonic
1002524166 5:179806428-179806450 CGCTCCCGCCGCCGACGCCCAGG + Intronic
1002639502 5:180624047-180624069 TGCTGCCGCCGCCGGCTGCCAGG + Exonic
1002771317 6:292611-292633 GGCAGCCGACGCCGGCGAGACGG - Intronic
1002887848 6:1312102-1312124 CGCAGCCGCGGCAGGCCAGCGGG + Intergenic
1002897960 6:1390052-1390074 CGCCGCCGCCGCCGCCGCCCCGG + Exonic
1002926818 6:1609832-1609854 GGCTGCCGCCGCTGGCGGGGCGG + Intergenic
1004044689 6:12012448-12012470 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1006472508 6:34236742-34236764 CGCCGCCGCCGCTGCCGCGCGGG - Intergenic
1006617944 6:35342571-35342593 CGCTGCGGCCGCCGCGGACCTGG + Intronic
1008649024 6:53544803-53544825 AGGGGCCGCCGCCGGGGAGCCGG - Exonic
1008673386 6:53795231-53795253 CGCCCCCGCCGCCGCCTAGCCGG - Exonic
1008673529 6:53795966-53795988 CGCAGCCACCGCAGGCCAGCCGG - Intronic
1009437627 6:63636077-63636099 CGCTGCCGCCGCCGAAGAGGAGG - Exonic
1013117652 6:107115046-107115068 CGCTGCCGCCGCCGCGCGGCCGG + Intronic
1013793610 6:113860180-113860202 AGCTGCGGCCGCCGCCGAGGCGG + Exonic
1013836598 6:114342411-114342433 CGCCGCCGCCGCCTGCGTGTGGG - Exonic
1017164158 6:151391553-151391575 CGCCGCCGCCGCCGCCGCGCCGG - Intergenic
1017206397 6:151808104-151808126 CGCGGCCGCCGCCAACGCGCAGG + Exonic
1017311559 6:152982713-152982735 CGCTGCCGCCGCCCGAGGCCGGG + Intronic
1017672068 6:156778042-156778064 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1018156654 6:160991711-160991733 CGCCGCCACCGCCGCCGATCTGG + Intronic
1018400489 6:163415135-163415157 CGCCGCCGCCGCCGGAGAGGAGG - Exonic
1019111926 6:169724007-169724029 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1019404506 7:876638-876660 CGCCGCCGCCGCCATCGGGCCGG - Exonic
1019474251 7:1236437-1236459 CGCCGCCGCCGCCGCGGGGCTGG + Exonic
1020130533 7:5556458-5556480 CGCTGCGGCTGCCGGCGGGCCGG - Intronic
1020224928 7:6272516-6272538 CACTCCCGCAGCCGGCGAGCCGG + Exonic
1020270173 7:6590095-6590117 CGCTGCTGCCGCCGGCCAGCAGG - Exonic
1020275538 7:6622402-6622424 CGCCGCCGCCGCTGCCGTGCAGG - Exonic
1021231103 7:18086899-18086921 CGCCGCCGCCGCCGCCGCGCGGG - Intergenic
1024255436 7:47537114-47537136 CCCTGCCGCCCGCGGGGAGCCGG + Intronic
1025069679 7:55887596-55887618 CGCCGCCGCCGCCGCCGCGGTGG - Intronic
1029390753 7:100272328-100272350 TGCTGCCGCCGCCGGGCGGCCGG + Intergenic
1031043449 7:116862571-116862593 CGCTGCCGCCGCCGCCGCCGCGG + Exonic
1031966638 7:128031960-128031982 TGCTGCCGCCGCTAGCCAGCGGG - Intronic
1032174353 7:129611692-129611714 CGCCGCCGCCGCCGAGGAGGGGG - Exonic
1032174357 7:129611695-129611717 CGCCGCCGCCGCCGCCGAGGAGG - Exonic
1035169567 7:157010041-157010063 CGCCGCCGCCGCCCGCGCCCAGG + Exonic
1041552684 8:59119264-59119286 CGCTGCCGCCGCCGCCGGGCAGG + Intergenic
1041690272 8:60680037-60680059 AGCTGCCGCCGCCGGCGGCCCGG - Intronic
1042040035 8:64580732-64580754 CGCTGCCGCCGCCGCCGCCTCGG - Exonic
1042040198 8:64581351-64581373 CGCTGGCGCCGCCGTGGAGGTGG - Exonic
1042859142 8:73295406-73295428 CGCTGCCGGCGCCGGTGATGAGG - Exonic
1043502957 8:80874323-80874345 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1048009387 8:130443719-130443741 CGCGCCCTCCGCCGCCGAGCGGG - Intergenic
1048214267 8:132480871-132480893 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1048881858 8:138877945-138877967 GGCTGCGGCCGTCGGTGAGCAGG + Exonic
1049585306 8:143430169-143430191 CGCCGCCGCCGCCGGTGCCCGGG + Exonic
1049681042 8:143918393-143918415 CGATGCCGCCGGTGGCCAGCTGG + Exonic
1050437929 9:5629199-5629221 CGCCGCCGCCGCCGCCGACTCGG + Exonic
1052888839 9:33677021-33677043 CGCCGCCGCCGCCGCCGTGTTGG + Intergenic
1052903989 9:33817739-33817761 CGCCGCCGCCGCCGCCGCGATGG + Exonic
1054835650 9:69672545-69672567 CGCCGCCGCCGCGGGCTCGCGGG - Intergenic
1056216261 9:84408582-84408604 CACTGCCGGAGCCGGCGGGCCGG - Intergenic
1057259553 9:93576333-93576355 CGCTCCCGCCGCCGGGAAGGCGG - Intergenic
1057739187 9:97697131-97697153 CGCAGCCGCCGTCGCCGAGTAGG + Exonic
1057869777 9:98708894-98708916 CGCTGCCGCCGCCGCCGCCGCGG - Exonic
1057934014 9:99221763-99221785 CGCTGGCGCTGCAGGCGCGCGGG - Exonic
1059234615 9:112751067-112751089 CGCTGCTGGAGCCGGCCAGCGGG - Exonic
1060244224 9:121930612-121930634 CGCTGCCACTGCCGGCTGGCTGG - Intronic
1060970569 9:127735180-127735202 CGCGGCCGCCGCCTGGGACCTGG - Exonic
1060977102 9:127771238-127771260 CGCTGTCGCCGCCGGCAACCCGG + Intronic
1061158895 9:128882176-128882198 CGCTGCGGCCGGCGGCGGGACGG + Intronic
1061559676 9:131394349-131394371 CGCGGCCGCCGCCGGGGGCCCGG + Intronic
1061610045 9:131740039-131740061 CGCTCCCCCGGCCCGCGAGCCGG + Intronic
1061666419 9:132163009-132163031 CGCTGCCGCCTGTGGCGACCCGG - Intronic
1062537625 9:137027882-137027904 CGCTGCGGCCTCCGGGGAGGTGG - Exonic
1062659198 9:137619365-137619387 CGCCGCCGCCGCCCGCAAGCCGG + Intronic
1203469881 Un_GL000220v1:111685-111707 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203471351 Un_GL000220v1:116564-116586 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1203477702 Un_GL000220v1:155657-155679 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203479172 Un_GL000220v1:160536-160558 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1186660563 X:11664684-11664706 CGCTCCCGCAGCCGCCGATCAGG + Exonic
1187155810 X:16719702-16719724 CGCGGCGGCGGCCCGCGAGCGGG + Exonic
1188003523 X:25002639-25002661 CGCCGCCGCCGCCGGCCAGTCGG - Intergenic
1195138207 X:101931892-101931914 CGCCGCCGCCGCTGCCGCGCAGG + Intronic
1196842543 X:119871810-119871832 CCCCGCGGCCGCCCGCGAGCGGG - Exonic
1200080652 X:153574810-153574832 CGATGCCACTGCCGGCCAGCTGG - Intronic
1200100746 X:153688279-153688301 CGCCGCCGCCGCCGCCCGGCCGG + Exonic
1200292483 X:154886325-154886347 CGCCGCCGCAGCTGGCGGGCGGG - Intronic
1200339327 X:155382065-155382087 CGCCGCCGCAGCTGGCGGGCGGG - Intergenic
1200347143 X:155458628-155458650 CGCCGCCGCAGCTGGCGGGCGGG + Exonic