ID: 1178992647

View in Genome Browser
Species Human (GRCh38)
Location 21:37367737-37367759
Sequence ATTTTAGGAGGAGGCGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178992636_1178992647 10 Left 1178992636 21:37367704-37367726 CCGAGGCCGGCCGGGCGGAGGGA No data
Right 1178992647 21:37367737-37367759 ATTTTAGGAGGAGGCGCCGCGGG No data
1178992629_1178992647 21 Left 1178992629 21:37367693-37367715 CCGGGCCGGAGCCGAGGCCGGCC No data
Right 1178992647 21:37367737-37367759 ATTTTAGGAGGAGGCGCCGCGGG No data
1178992626_1178992647 27 Left 1178992626 21:37367687-37367709 CCGCAGCCGGGCCGGAGCCGAGG No data
Right 1178992647 21:37367737-37367759 ATTTTAGGAGGAGGCGCCGCGGG No data
1178992640_1178992647 0 Left 1178992640 21:37367714-37367736 CCGGGCGGAGGGAGGGACCTGCC No data
Right 1178992647 21:37367737-37367759 ATTTTAGGAGGAGGCGCCGCGGG No data
1178992625_1178992647 28 Left 1178992625 21:37367686-37367708 CCCGCAGCCGGGCCGGAGCCGAG No data
Right 1178992647 21:37367737-37367759 ATTTTAGGAGGAGGCGCCGCGGG No data
1178992639_1178992647 4 Left 1178992639 21:37367710-37367732 CCGGCCGGGCGGAGGGAGGGACC No data
Right 1178992647 21:37367737-37367759 ATTTTAGGAGGAGGCGCCGCGGG No data
1178992632_1178992647 16 Left 1178992632 21:37367698-37367720 CCGGAGCCGAGGCCGGCCGGGCG No data
Right 1178992647 21:37367737-37367759 ATTTTAGGAGGAGGCGCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178992647 Original CRISPR ATTTTAGGAGGAGGCGCCGC GGG Intronic